Commit 9fa2024b authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

tests: update

parent c6a57bd9
Pipeline #231877 passed with stages
in 36 minutes and 18 seconds
......@@ -2,7 +2,8 @@
!LAUNCH: $VIDJIL_DIR/$EXEC -c windows -g $VIDJIL_DIR/germline -r 1 -1 -2 -K bug4225-j.fa
$ Show name and sequence
1:>igkj1 GTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC
1:>igkj1
1:GTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC
$ Display three lines per system
3:TRG
......
......@@ -3,7 +3,7 @@
# Testing .affects output (-K)
$ First sequence (TRA), display sequence
1:>TRA.* TCTTCATTCCTTAGTCGCTCTGATAGTTATGGTTACCTCCTTCTACAGGAGCTCCAGATGAAAGACTCTGCCTCTTACTTCTGCGCTGTGAGAGAGTATGAAAGTATTACCTCCCAGTTGCAATTTGGCAAAGGAACCAGAGTTTCCACTTCTCC
1:TCTTCATTCCTTAGTCGCTCTGATAGTTATGGTTACCTCCTTCTACAGGAGCTCCAGATGAAAGACTCTGCCTCTTACTTCTGCGCTGTGAGAGAGTATGAAAGTATTACCTCCCAGTTGCAATTTGGCAAAGGAACCAGAGTTTCCACTTCTCC
$ First sequence (TRA), count of k-mers
1:129 .* TRA
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment