Commit 9f73c16f authored by flothoni's avatar flothoni

Add a test sequence with pattern {Fw}GxG, but also with an out of frame codon.

Should be seen as productive
Link to #4006
parent e4ca303a
Pipeline #178016 failed with stages
in 7 minutes and 19 seconds
>seq_with_out_of_frame_AND_correct_pattern
GGTGCCCACTCCCAGGTGCAGTTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGATACACCTTCACCACTTATGATGTCAACTGGGTGCGACAGGCCACTGGACAAGGGCTTGAGTGGATGGGATGGATGAACTCTGATAGTGGTAACACAGGCTATGCACAGAAATTCCAGGGCAGAGTCACCATGACCAGGAACACCTCCATAAGTACAGCCTACATGGAACTGAGCAGTCTGAGATCTGAGGACACGGCCGTCTTTTACTGTGCCCTCACACGTAGAGATAGTAGTGCTTATTTTGCCTTTGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAG
# seqNT ... tgt gcc CTC ACA CGT AGA GAT AGT AGT GCT TAT ttt GCC TTT GGC CAG GGA ACC CTG GTC ACC GTC TCC TCA GGT AAG
# seqAA C A L T R R D S S A Y F A F G Q G T R V T V S S G K
# seqVidjil C A L T R R D S S A Y # C L W
# The `#` is due to a out of frame codon at the first TTT. The sequence is seen as unproductive by vidjil.
# But the pattern {FW}GxG is present, and the sequence should probably be seen as productive.
!OUTPUT_FILE: out/4600_pattern_WF_GxG.vidjil
!LAUNCH: $VIDJIL_DIR/$EXEC -g $VIDJIL_DIR/germline/homo-sapiens-isoforms.g -r 1 $VIDJIL_DATA/4006_pattern_WF_GxG.fa
# Sequence have a out of frame nt, and a correct pattern {FW}GxG. So shoul probably be seen as productive
$ Clone found
1: "IGHV1-8*01 6/CCTCACACGTAGA/10 IGHD3-22*01 5//6 IGHJ4*02"
$ The sequence is productive
1: "productive": true
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment