Une MAJ de sécurité est nécessaire sur notre version actuelle. Elle sera effectuée lundi 02/08 entre 12h30 et 13h. L'interruption de service devrait durer quelques minutes (probablement moins de 5 minutes).

Commit 9f5fbc10 authored by Mikaël Salson's avatar Mikaël Salson Committed by Mathieu Giraud
Browse files

10-germlines-IGHD-upstream.should-get: IGHD2-2 upstream sequence

chromosome:GRCh38:14:105916826:105916885:-1

See #3009
parent b33f6e9d
!NO_LAUNCHER:
!LAUNCH: (cd $VIDJIL_DIR/germline ; grep -A1 -F 'IGHD2-2*02' homo-sapiens/IGHD+up.fa)
$ Correct sequence, with upstream
1:AGGATTTTGTGGGGGCTCGTGTCACTGTGA
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment