Commit 9c2b6a90 authored by Mikaël Salson's avatar Mikaël Salson
Browse files

Tests: Changes in germline dataset

Changes in some sequences (in particular IGHV7-40*03) are responsible for
those number changes. There is no such changes when using the previous
germline dataset.

For information IGHV7-40*03 changed from:
>Z12320|IGHV7-40*03|Homo sapiens|P|V-REGION|1..291|289 nt|1| | | | |289+0=289|partial in 5'| |
ctgcagctggtgcagtctgggcctgaggtgaagaagcctggggcctcagtgaaggtctcc
tataagtcttctggttacaccttcaccatctatggtatgaattgggtatgatagacccct
ggacagggctttgagtggatgtgatggatcatcacctacactgggaacccaacgtatacc
cacggcttcacaggatggtttgtcttctccatggacacgtctgtcagcacggcgtgtctt
cagatcagcagcctaaaggctgaggacacggccgagtattactgtgcga
to:
>AC241995|IGHV7-40*03|Homo sapiens|P|V-REGION|10101..10396|296 nt|1| | | | |296+0=296| | |
ttttcaatagaaaagtcaaataatctaagtgtcaatcagtggatgattagataaaatatg
atatatgtaaatcatggaatactatgcagccagtatggtatgaattcagtgtgaccagcc
cctggacaagggcttgagtggatgggatggatcatcacctacactgggaacccaacatat
accaacggcttcacaggacggtttctattctccatggacacctctgtcagcatggcgtat
ctgcagatcagcagcctaaaggctgaggacacggccgtgtatgactgtatgagaga
parent 80d0e0d6
......@@ -11,10 +11,10 @@ $ Parses germline/IGHJ.fa
1: 701 bp in 13 sequences
$ Find the good number of "too short sequences" for windows of size 100
1: SEG, but no window -> 2046
1: SEG, but no window -> 2052
$ Find the good number of segmented sequences (including "too short sequences")
1: segmented 11220 reads .85.3%.
1: segmented 11216 reads .85.3%.
$ Find the good number of windows of size 100 in Stanford S22
1: found 8233 100-windows in 9174 segments
1: found 8224 100-windows in 9164 segments
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment