Commit 9b99eb0d authored by Mathieu Giraud's avatar Mathieu Giraud

tests: update a test and promoting it from .should-locus to .should-vdj

It is better to segment the first sequence without D.
parent b1ca27e3
>TRDV2*01 TRDJ1*01 TRD # is there a D-REGION of length 5 ?
>TRDV2*01_0//0_TRDJ1*01 TRD
gcaccatcagagagagatgaagggtcttactactgtgcctgtgacacc
acaccgataaactcatctttggaaaaggaacccgtgtgactgtggaaccaa
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment