Commit 9a186312 authored by Mikaël Salson's avatar Mikaël Salson

algo/tests: Add test for different seeds for V and J.

See #3954
parent 539eaf60
{
"ref": "http://www.vidjil.org/germlines/germline-59.tar.gz",
"species": "Homo sapiens",
"species_taxon_id": 9606,
"path": "../../../germline/homo-sapiens",
"systems": {
"IGH": {
"shortcut": "H",
"color" : "#6c71c4",
"description": "Human immunoglobulin, heavy locus (14q32.33)",
"recombinations": [ {
"5": ["IGHV.fa"],
"4": ["IGHD.fa"],
"3": ["IGHJ+down.fa"]
} ],
"parameters": {
"seed": "12s",
"seed_3": "8c"
}
}
}
}
>ighv-ighj
gacacctctgccagcacagcatacctgcagatcagcagcctaaaggctgaggacatggccatgtattactgtgcgagata
attactact
!LAUNCH: $VIDJIL_DIR/$EXEC -r 1 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/short-j.fa
$ Both seeds for IGH are identical
1: IGH .* ######-###### .* ######-######
$ With default seeds the J is not found as it is too short
1: UNSEG only V/5' -> 1
!LAUNCH: $VIDJIL_DIR/$EXEC -r 1 -g $VIDJIL_DATA/seeds.g $VIDJIL_DATA/short-j.fa
$ With different seeds we don't have the same seed for the IGHV and IGHJ
1: IGH .* ######-###### .* ########
$ The sequence is segmented
1: SEG -> 1
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment