Commit 99f9172d authored by Mikaël Salson's avatar Mikaël Salson
Browse files

should-get: Add possibility to provide default option to launch Vidjil

This will help testing the effect of some parameter on all the functional tests.
parent 8f60638b
!LAUNCH: $VIDJIL_DIR/vidjil -c segment -3 -g $VIDJIL_DIR/germline -i ../should-vdj-tests/Demo-X5.should-vdj.fa
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -c segment -3 -g $VIDJIL_DIR/germline -i ../should-vdj-tests/Demo-X5.should-vdj.fa
$ Detects a CDR3 on regular V(D)J recombinations
1: IGH SEG.* [{].*[}]
......
!LAUNCH: $VIDJIL_DIR/vidjil -A -t 0 -g $VIDJIL_DIR/germline -2 -i $VIDJIL_DIR/data/chimera-fake.fa
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -A -t 0 -g $VIDJIL_DIR/germline -2 -i $VIDJIL_DIR/data/chimera-fake.fa
$ The KmerSegmenter segments the three chimera reads on PSEUDO_MAX12 germline (-2)
1:xxx .* -> .* 3
......
!LAUNCH: $VIDJIL_DIR/vidjil -A -g $VIDJIL_DIR/data/chimera-fake-VJ-germlines.data -i $VIDJIL_DIR/data/chimera-fake-VJ.fa
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DIR/data/chimera-fake-VJ-germlines.data -i $VIDJIL_DIR/data/chimera-fake-VJ.fa
# Testing a custom (fake) germlines.data
$ Loads from 'chimera-fake-VJ-germlines.data' a custom germline
......
!LAUNCH: $VIDJIL_DIR/vidjil -A -g $VIDJIL_DIR/germline -i -2 $VIDJIL_DIR/data/chimera-fake-VJ.fa
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DIR/germline -i -2 $VIDJIL_DIR/data/chimera-fake-VJ.fa
$ The KmerSegmenter segments the five chimera reads on PSEUDO_MAX12 germline (-2)
1:xxx .* -> .* 5
......
!LAUNCH: $VIDJIL_DIR/vidjil -e 100 -A -t 0 -g $VIDJIL_DIR/germline -4 -i $VIDJIL_DIR/data/chimera-fake-half.fa
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -e 100 -A -t 0 -g $VIDJIL_DIR/germline -4 -i $VIDJIL_DIR/data/chimera-fake-half.fa
# TODO: a more precise modeling should give a e-value computation that could make this work even with -e 1
$ The KmerSegmenter segments the six chimera reads on PSEUDO_MAX1U germline (-4)
......
!LAUNCH: $VIDJIL_DIR/vidjil -g $VIDJIL_DIR/germline -i $VIDJIL_DIR/data/chimera-fake.fa
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline -i $VIDJIL_DIR/data/chimera-fake.fa
$ Do not segment on any germline, even incomplete
1:junction detected in 0 reads
......
!LAUNCH: $VIDJIL_DIR/vidjil -A -uU -g $VIDJIL_DIR/germline $VIDJIL_DIR/data/chimera-trg.fa
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -A -uU -g $VIDJIL_DIR/germline $VIDJIL_DIR/data/chimera-trg.fa
$ Do not segment on IGL by chance
1:IGL .* -> .* 0
......
!LAUNCH: $VIDJIL_DIR/vidjil -G $VIDJIL_DIR/germline/TRG -c clones -A -3 $VIDJIL_DIR/data/segment_lec.fa
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -G $VIDJIL_DIR/germline/TRG -c clones -A -3 $VIDJIL_DIR/data/segment_lec.fa
$ Extract 50bp windows (TRG)
1:found . 50-windows
......
!LAUNCH: $VIDJIL_DIR/vidjil -k 14 -w 50 -c clones -G $VIDJIL_DIR/germline/IGH -y 3 -z 1 -r 1 $VIDJIL_DIR/data/clones_simul.fa
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -k 14 -w 50 -c clones -G $VIDJIL_DIR/germline/IGH -y 3 -z 1 -r 1 $VIDJIL_DIR/data/clones_simul.fa
$ Junction extractions
1:found 25 50-windows in 66 reads
......
!LAUNCH: $VIDJIL_DIR/vidjil -k 14 -w 50 -c clones -G $VIDJIL_DIR/germline/IGH -y 3 -z 0 -r 1 -n 5 $VIDJIL_DIR/data/clones_simul.fa ; cat out/clones_simul.vidjil
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -k 14 -w 50 -c clones -G $VIDJIL_DIR/germline/IGH -y 3 -z 0 -r 1 -n 5 $VIDJIL_DIR/data/clones_simul.fa ; cat out/clones_simul.vidjil
$ Window extractions
2:found 25 50-windows in 66 reads
......
!LAUNCH: $VIDJIL_DIR/vidjil -KA -z 0 -s \\\\#\\\\#\\\\#\\\\#\\\\#-\\\\#\\\\#\\\\#\\\\#\\\\# -G $VIDJIL_DIR/germline/IGH $VIDJIL_DIR/data/common-V-D.fa ; cat out/common-V-D.affects
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -KA -z 0 -s \\\\#\\\\#\\\\#\\\\#\\\\#-\\\\#\\\\#\\\\#\\\\#\\\\# -G $VIDJIL_DIR/germline/IGH $VIDJIL_DIR/data/common-V-D.fa ; cat out/common-V-D.affects
$ Segments the sequence
1: SEG .* -> .* 1
......
!NO_LAUNCHER:
!LAUNCH: $VIDJIL_DIR/vidjil -G $VIDJIL_DIR/germline/IGH $VIDJIL_DIR/data/clones_simul.fa > out-fa ; $VIDJIL_DIR/vidjil -G $VIDJIL_DIR/germline/IGH -b clones_simul $VIDJIL_DIR/data/clones_simul.fa.gz > out-fa-gz ; diff -s -I '\#' -I 'index' -I 'data/clones_simul' out-fa out-fa-gz ; echo 'Diff: '\\$?; wc -l out-fa-gz
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -G $VIDJIL_DIR/germline/IGH $VIDJIL_DIR/data/clones_simul.fa > out-fa ; $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -G $VIDJIL_DIR/germline/IGH -b clones_simul $VIDJIL_DIR/data/clones_simul.fa.gz > out-fa-gz ; diff -s -I '\#' -I 'index' -I 'data/clones_simul' out-fa out-fa-gz ; echo 'Diff: '\\$?; wc -l out-fa-gz
$ Identical output
1:Diff: 0
......
!LAUNCH: $VIDJIL_DIR/vidjil -G $VIDJIL_DIR/germline/IGH -r 1 $VIDJIL_DIR/data/large_N.fa
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -G $VIDJIL_DIR/germline/IGH -r 1 $VIDJIL_DIR/data/large_N.fa
$ Find a huge insertion in the segmentation
1:>clone-001.*/[ACGT]{100}
!LAUNCH: (for i in {1..100000}; do echo '>read' ; echo ccgtgtattactgtgcgagagagctgaatacttccagcactg ; done ;) > same-igh-100k.fa ; $LAUNCHER $VIDJIL_DIR/vidjil -G $VIDJIL_DIR/germline/IGH -r 5000 -w 15 same-igh-100k.fa; rm -f same-igh-100k.fa
!LAUNCH: (for i in {1..100000}; do echo '>read' ; echo ccgtgtattactgtgcgagagagctgaatacttccagcactg ; done ;) > same-igh-100k.fa ; $LAUNCHER $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -G $VIDJIL_DIR/germline/IGH -r 5000 -w 15 same-igh-100k.fa; rm -f same-igh-100k.fa
$ Find a unique clone with all reads
1:>clone-001--IGH--0100000--100.--window
......
!LAUNCH: $VIDJIL_DIR/vidjil -g $VIDJIL_DIR/germline $VIDJIL_DIR/data/multi-complete.fa
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline $VIDJIL_DIR/data/multi-complete.fa
$ Segment all the seven reads
1:junction detected in 7 reads
......
!LAUNCH: $VIDJIL_DIR/vidjil -g $VIDJIL_DIR/germline -i $VIDJIL_DIR/data/multi-complete.fa
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline -i $VIDJIL_DIR/data/multi-complete.fa
$ Segment all the seven reads
1:junction detected in 7 reads
......
!LAUNCH: $VIDJIL_DIR/vidjil -g $VIDJIL_DIR/germline -i $VIDJIL_DIR/data/multi-short.fa
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline -i $VIDJIL_DIR/data/multi-short.fa
$ Segment all the seven reads
1:junction detected in 7 reads
......
!LAUNCH: $VIDJIL_DIR/vidjil -r 5 -K -g $VIDJIL_DIR/germline $VIDJIL_DIR/data/multi-short.fa ; head -n 17 out/multi-short.affects
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -r 5 -K -g $VIDJIL_DIR/germline $VIDJIL_DIR/data/multi-short.fa ; head -n 17 out/multi-short.affects
# Testing .affects output (-K)
$ First sequence (TRA), display sequence
......
!LAUNCH: $VIDJIL_DIR/vidjil -g $VIDJIL_DIR/germline $VIDJIL_DIR/data/multi-short.fa
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline $VIDJIL_DIR/data/multi-short.fa
$ Segment all the seven reads
1:junction detected in 7 reads
......
!LAUNCH: $VIDJIL_DIR/vidjil -c segment -g $VIDJIL_DIR/germline $VIDJIL_DIR/data/multi-tiny.fa
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -c segment -g $VIDJIL_DIR/germline $VIDJIL_DIR/data/multi-tiny.fa
$ Do not segment any of the seven reads
7:UNSEG
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment