Commit 98ee18a5 authored by Thonier Florian's avatar Thonier Florian Committed by Mathieu Giraud

should-get, add a test on name of unsegmented clone

link to #3890
parent fd61836f
>unexpected_name
TGTTTGCAGGTGTCCAGTGTCAGGTGAAACTGGTGGAGTCTGGGGGAGGCGTGGTCCGCCCTGGGAGGTCCCTGAGACTCTCCTGTGCCGACCTCCAGGACAGAGGACGCTGGGCCCAGAGAGACGAGGCAGAAAGAACCCCTCGTTCTTGAAGAGACGGTGACCATCGTCCCTTGGCCGCAGATATCGAAAGCATCATTTCCCCTGTCACAGTAGTCGATTCTACTAAAAGAGTCGCGGCCCCTAGTTTGACTACTGGGGCCAGAGAACCCTGGTCACCGTCTCCTCAGGTAAG
\ No newline at end of file
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g -r 1 $VIDJIL_DATA/unexpected_name.fa ; cat out/unexpected_name.vidjil
$ Now name of unsegmented sequence is the 'code' given by vidjil-algo
1: "clone-001--IGH--0000001--100%--clone_mauvaise_denomination1-[0,294]-#1 - 295 bp (100% of 295.0 bp)"
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment