Commit 98eb25ed authored by Mikaël Salson's avatar Mikaël Salson
Browse files

2767-Debre-IGH.should-vdj.fa: IGHJ4*01 or IGHJ4*02 are good solutions

IGHJ4*02 is actually slightly better than IGHJ4*01, because one insertion and
one deletion (with IGHJ4*01) are replaced with two substitutions (IGHJ4*02)
parent e19c84d1
Pipeline #15203 passed with stages
in 25 minutes and 55 seconds
......@@ -22,13 +22,13 @@ CTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAG
#This sequence may be problematic due to a long deletion ( > 100 nt)
>IGHV3-7*01 (112/CCAGGACC/6, 112/CC/0) IGHD2-2 (16/GAATACCTAGTACC/12, 16/GAATACCTAGT/9, 16/GAA/2) IGHJ4*01 [IGH]
>IGHV3-7*01 (112/CCAGGACC/6, 112/CC/0) IGHD2-2 (16/GAATACCTAGTACC/12, 16/GAATACCTAGT/9, 16/GAA/2) (IGHJ4*01, IGHJ4*02) [IGH]
CTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCAGGATTCTCCTTTAGTAGCTTTGACATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGAGTGGCACATATCTGGAATGATGGAAGTCAGAAATGCTCTGCGG
CCAGGACCTTGTAGTAGGAA
TACCTAGTACCACTGGGGCAAGGAAACCCTGGTCACCGTCTCCTCAGGT
#>IGHV3-7*01 AGCTATTGGATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTGGCCAACATAAAGCAAGATGGAAGTGAGAAATACTATGTGGactctgt... actactttg-actactggggccaaggaaccctggtcaccgtctcctcag IGHJ4*01
# ||||*|***|||||||||||||||||||||||||||||||||||||||||*|||||*|**||***|*|*|||||||||*||||||*||*||*|| |||*|*| ||*||||||||||||||
#>IGHV3-7*01 AGCTATTGGATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTGGCCAACATAAAGCAAGATGGAAGTGAGAAATACTATGTGGactctgt... actactttg-actactggggccagggaaccctggtcaccgtctcctcag IGHJ4*02
# ||||*|***|||||||||||||||||||||||||||||||||||||||||*|||||*|**||***|*|*|||||||||*||||||*||*||*|| |||*|*| ||*|||||||| ||| ||||||||
#>Clone_complet agctttgacatgagctgggtccgccaggctccagggaaggggctggagtgagtggcacatatctggaaTGATGGAAGTCAGAAATGCTCTGCGGCCAGGACCTTGTAGTAGGAATACCTAGTACCACTGGGGCAAGGAAACCCTGGTCACCGTCTCCTCAGGT
# **|****|||||**||||||||||||||||||||||||||||||||||||*||*|*|**||***|*|| ||||**|||||||||
#>IGHV3-72*02 GACCACTACATGGACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTGGCCGTACTAGAAAcaaagctaacag... ||||**|||||||||
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment