Commit 98e37b14 authored by flothoni's avatar flothoni Committed by Mathieu Giraud

algo/tests; add test on sequence wih stop codon before V start

Should fail for the moment
Link to #2142
parent 4123a20b
# These sequences have stop codon before the start of the V gene
# result should be productive
>IGHV1-69*06 2/AACCCCCAACAAAGC/4 IGHD3-3*01 9/CCCATAAGTACCGT/1 IGHJ6*02 [IGH]
CTGGAGGTTCCTCTTTGTGGTGGCAGCAGCTACAGGTAAGGGGCTTCCTAGTCCTAAGGCTGAGGAAGGGATCCTGGTTTAGTTAAAGAGGATTTTATTCACCCCTGTGTCCTGTCCACAGGTGTCCAGTCCCAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCTTTGGTACAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACAAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAAACCCCCAACAAAGCTACGATTTTTGGAGTGGTCCCATAAGTACCGTTTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTAAG
>IGHV3-74*01 0/GACCG/6 IGHD1-7*01 0/GC/10 IGHJ4*02 [IGH]
AGCTGGGTTTTCCTTGTTGCTATTTTAAAAGGTGATTCATGGAGAATTGGAGATGTGGAGTGTGAATGGACATGGGTGAGATAAGCAGTGGATGTGTGTGGCAGTTTCTGACCAGGGTGTCTCTGTGTTTGCAGGTGTCTCGTGTGAGGTGCTTCTGGTGGAGTCCGGGGGAGGCTTAGTTAAGGCGGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAATTACTGGATGCACTGGGTCCGCCAAGTTCCAGGGAAGGGCCTGGAGTGGGTCTCACGTATTAACAGCGATGGGAGCGCCATAAGGTACGCGGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGGACACACTGTATCTGCAAATGAACAGTCTGAGAGCCGAGGACACGGCTGTTTATTATTGTGCAAGAGAGACCGACTGGAATTACGCCTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAG
!LAUNCH: $VIDJIL_DIR/$EXEC -c designations -3 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/productive_stop_before_V.fa
!OUTPUT_FILE: out/productive_stop_before_V.vidjil
$ first clone name
1: "IGHV1-69*06 2/AACCCCCAACAAAGC/4 IGHD3-3*01 9/CCCATAAGTACCGT/1 IGHJ6*02"
$ second clone name
1: "IGHV3-74*01 0/GACCG/6 IGHD1-7*01 0/GC/10 IGHJ4*02"
$ We should get 6 start position in vidjil (2 by segments)
6: "start"
$ We should get 6 stop position in vidjil (2 by segments)
6: "stop"
$ But only one productive
2: "productive": true
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment