Commit 975d667b authored by Mikaël Salson's avatar Mikaël Salson

segmenter_test.js: Include downstream region

parent aee3e41c
Pipeline #33688 passed with stages
in 51 minutes and 48 seconds
......@@ -160,7 +160,7 @@ QUnit.test("segt", function (assert) {
assert.equal(segment.sequence[2].seq.join(" "),"c c c c c c c c c c c c c c c c c c c c", "clone 3 sequence")
assert.equal(segment.sequence["IGHV1-2*01"].seq.join("").toLowerCase(),"caggtgcagctggtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacaccttcaccggctactatatgcactgggtgcgacaggcccctggacaagggcttgagtggatgggacggatcaaccctaacagtggtggcacaaactatgcacagaagtttcagggcagggtcaccagtaccagggacacgtccatcagcacagcctacatggagctgagcaggctgagatctgacgacacggtcgtgtattactgtgcgagaga","5 germline")
assert.equal(segment.sequence["IGHD2-2*02"].seq.join("").toUpperCase(),"GCGGGGACAGGAGGATTTTGTGGGGGCTCGTGTCACTGTGAGGATATTGTAGTAGTACCAGCTGCTATACC","4 germline")
assert.equal(segment.sequence["IGHJ6*01"].seq.join("").toLowerCase(),"attactactactactacggtatggacgtctgggggcaagggaccacggtcaccgtctcctcag","3 germline")
assert.equal(segment.sequence["IGHJ6*01"].seq.join("").toLowerCase(),"attactactactactacggtatggacgtctgggggcaagggaccacggtcaccgtctcctcagaagaatggccactctagggcctttgttttctgctactgcc","3 germline")
segment.addSequenceTosegmenter("test","igh", "accccccgtgtagtagtcc")
assert.equal(segment.sequence["test"].seq.join("").toLowerCase(),"accccccgtgtagtagtcc"," test sequence ")
Markdown is supported
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment