Commit 96ba9051 authored by Mathieu Giraud's avatar Mathieu Giraud

Merge branch 'dev' into feature/evalue-d

parents 28229b78 513e978b
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -c segment -g $VIDJIL_DIR/germline/mus-musculus.g $VIDJIL_DIR/data/example_mouse.fa
$ Segment sequence on IGK
1:segIGK.*IGKV.*IGKJ
$ Segment sequence on IGH
1:segIGH.*IGHV.*IGHD.*IGHJ
$ Segment sequence on IGL
1:segIGL.*IGLV.*IGLJ
......@@ -217,8 +217,8 @@ def should_result_to_tap(should_pattern, result, tap_id):
should_regex = should_pattern_to_regex(should_pattern)
# match = should_regex.search(result)
match = os.system("echo '%s' | grep -E '%s' > /dev/null 2>&1" \
% (result.replace("'", "\\'"),
should_regex.pattern.replace("'", "\\'")))
% (result.replace("'", "'\\''"),
should_regex.pattern.replace("'", "'\\''")))
found = (match == 0)
globals()['global_stats'][locus] += 1
......
>segIGK
GGGAGTCATTCTTGGTCAGGAGACGTTGTAGAAATGAGACCGTCTATTCAGTTCCTGGGG
CTCTTGTTGTTCTGGCTTCATGGTGCTCAGTGTGACATCCAGATGACACAGTCTCCATCC
TCACTGTCTGCATCTCTGGGAGGCAAAGTCACCATCACTTGCAAGGCAAGCCAAGACATT
AACAAGTATATAGCTTGGTACCAACACAAGCCTGGAAAAGGTCCTAGGCTGCTCATACAT
TACACATCTACATTACAGCCAGGCATCCCATCAAGGTTCAGTGGAAGTGGGTCTGGGAGA
GATTATTCCTTCAGCATCAGCAACCTGGAGCCTGAAGATATTGCAACTTATTATTGTCTA
CAGTATGATAATCTGTGGACGTTCGGTGGAGGCACCAAGCTGGAAATCAAACGGGCTGAT
GCTGCACCAACTGTATCCATCTTCCCACCATCCAGTG
>segIGH
GGGAAGACATTTGGGAAGGACTGACTCTCTGAGGAGACTGTGAGAGTGGTGCCTTGGCCCCAGTAGTCAAAGTAGCTACTACCGTAGTAATCGTATCTTGCACAATAATAGACCGCAGAGTCCTCAGATGTCAGGCTGCTGAGCTGCATGTAGGCTGTGCTGGAGGGTTTGTCTACAGTCAGTGTGGCCTTGCTCTTGAACTTCTCATTGTACTTAGTACCACCACTATTAGGATCAATCCTTCCAATCCACTCAAGGCCTCGTCCAGGCCTCTGCTTCACCCAGTGCATCCAGTAGCTGGTGAAGGTGTAGCCAGAAGCCTTGCAGGACAGCTTCACTGAAGCCCCAGGCTTCACAAGCTCAGCCCCAGGCTGCTGCAGTTGGACCTGGGAGTGGACACCTGTAGCTGTTGCTACCAAGAAGAGGATGATACAGCTCCATCCCATAGTGAGGTCCTGTGTGCTCAGTAACTGTAAAGAGAACAGTGATCTCAACCCGTATTTATGAAGTGAAGTATT
>segIGL
GAGAGTGGGAGTGGACTTGGGCTGACCTAGGACAGTGACCTTGGTTCCACTGCCGAAAATAAATGGTTGCTGTACCATAGAGCACAGAAATATATTGCCTCATCCTCAGTCTGTGCCCCTGTGATGGTGAGGGCAGCCTTGTCTCCAATCAGGGAGCCTGAGAATCTGGCAGGAACACCTGGAGCTCGGTTGTTGGTACCACCTATTAGACCAGTGAATAAATGATCTGGTTTTTCTTGGACCCAGTTGGCATAGTTACTAGTTGTAACAGCCCCAGTACTTGAGCGACAAGTGAGTGTGACTGTTTCACCAGGTGATGTGGTGAGTGCAGATTCGTGAGTCACAACAGCCTGGGAAATGGCCCCTGAGCTGAGAGCCAGGAGAGAGAGTATAAGTGAAATCCAGGCCATAATTCACAAACCAGGTCTATTCTTTTCAATATTGGTCCCCCGTAGATCGGTGTATTCACATTGTC
\ No newline at end of file
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment