Commit 94cf7825 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: json should parsing

see #3206
parent 7e571312
Pipeline #163332 failed with stages
in 11 minutes and 31 seconds
!REQUIRES: python $VIDJIL_DIR/tools/check_python_version.py
!LAUNCH: $VIDJIL_DIR/$EXEC -r 1 -z 0 -w 60 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta ; python $VIDJIL_DIR/tools/fuse.py out/Stanford_S22.vidjil out/Stanford_S22.vidjil -o out/fused.data ; cat out/fused.data | python $VIDJIL_DIR/tools/format_json.py -1
!OUTPUT_FILE: out/algo-then-fuse.vidjil
!OPTIONS: --mod jR
!LAUNCH: $VIDJIL_DIR/$EXEC -r 1 -z 0 -w 60 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta ; python $VIDJIL_DIR/tools/fuse.py out/Stanford_S22.vidjil out/Stanford_S22.vidjil -o out/algo-then-fuse.vidjil
$ Points list
1:"original_names": \[".*data//Stanford_S22.fasta", ".*data//Stanford_S22.fasta"\]
2:samples.original_names
:samples.original_names[0]: data//Stanford_S22.fasta
:samples.original_names[1]: data//Stanford_S22.fasta
$ Most abundant window, twice, fused
1:"id": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC".*"reads": \[8, 8\].*"top": 2
$ Most abundant window, twice, fused
:clones[0].id: CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC
:clones[0].reads: [8, 8]
:clones[0].top: 1
$ Windows that are not in the bottom of the distribution
1: "distribution": \{[^}]+ "0.00001": \[9062, 9062\]
# :reads.distribution.0.00001: should#59
:reads.distribution: [9062, 9062]
\ No newline at end of file
!LAUNCH: python ../../pear_structured_log.py -i ../data/pear_log.log -o ../data/pear_strucured.json; cat ../data/pear_strucured.json
!OUTPUT_FILE: ../data/pear_strucured.json
!LAUNCH: python ../../pear_structured_log.py -i ../data/pear_log.log -o ../data/pear_strucured.json
$ Correct number of assembled reads
1:"reads_assembled_number": 2972
!OPTIONS: --mod jR
1:"reads_total_number": 3000
$ Correct number of assembled reads
:reads.reads_assembled_number: 2972
:reads.reads_total_number: 3000
$ Correct number of unassembled reads
1:"reads_not_assembled_number": 28
:reads.reads_not_assembled_number: 28
$ Correct information on input files used by pear
1:"assembled_reads": "demo_set.fastq.assembled.fastq",
1:"discarded_reads": "demo_set.fastq.discarded.fastq",
1:"unassembled_forward": "demo_set.fastq.unassembled.forward.fastq",
1:"unassembled_reverse": "demo_set.fastq.unassembled.reverse.fastq"
:output_file.assembled_reads: demo_set.fastq.assembled.fastq
:output_file.discarded_reads: demo_set.fastq.discarded.fastq
:output_file.unassembled_forward: demo_set.fastq.unassembled.forward.fastq
:output_file.unassembled_reverse: demo_set.fastq.unassembled.reverse.fastq
$ Correct parameter return
1:"forward_file": "sequence_R1.fastq",
1:"minimum_overlap": "10",
1:"phred": "33",
1:"reverse_file": "sequence_R2.fastq",
1:"scoring_methode": "Scaled score",
1:"version": "PEAR v0.9.10 \[May 30, 2016\]"
:settings.forward_file: sequence_R1.fastq
:settings.minimum_overlap: 10
:settings.phred: 33
:settings.reverse_file: sequence_R2.fastq
:settings.scoring_methode: Scaled score
:settings.version: PEAR v0.9.10 \[May 30, 2016\]
$ Correct nucleotides frequencies
1:"base_frequency_a": "0.269874",
1:"base_frequency_c": "0.257653",
1:"base_frequency_g": "0.238808",
1:"base_frequency_t": "0.233665",
\ No newline at end of file
:base_frequency.base_frequency_a: 0.269874
:base_frequency.base_frequency_c: 0.257653
:base_frequency.base_frequency_g: 0.238808
:base_frequency.base_frequency_t: 0.233665
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment