Commit 946d8631 authored by Mikaël Salson's avatar Mikaël Salson
Browse files

shouldvdj: Sequences not to be segmented

Those sequences have colinear alignments on the genome.
They are not V(D)J recombinations, even if some kmer are shared with germlines.
parent e0496280
>__TRG_UNSEG
GGTAGTAGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGAAGGCTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGTCCTGAGAGA
>seq-317-1__TRG_UNSEG
ATGAAGTTTTTTTGATGGCTTGAGATGGCTCACAAATTTTGATTTTTTTTTCTTCCTTGTGCTCCCTTTTTTTCTCCTTGCTTTTCCAGTTAACATCTATATTCACATGTAATCTTGTTTTCTCTTCACATTCACTGAGTTGTTCAGGCT
>seq-317-2__TRD_UNSEG
GAAGGAAGAGATTTGAAATAAAGCTTTGGTTTCTGAGGAATGTTGCCGTTTGAGAGATTCAAAAAGAAAGAAGATCCAAATTTCGGGACTGGTGTTTAAATTGTAGTGACAGATTTTGGGGGCCATTAAAGGTATGGGAGTGAAA
>seq-317-3__TRD+_UNSEG
ACTAACAGTAACTGCCATTTTTTGTCTGTGATAACAGAGTGATTTGTAAAACAGTGGTTGTTTTTTCATTGTGTTTTCTTCGTGGATTGTTTTTTCTGCGGGTCATATTCATACCTTCTGATGAAGTTGTACAACACCAGCAACATT
>seq-317-4__IGK+_UNSEG
AGGTATGGTTGCGCTCAGTATAACAAGTGCTGAACAGAAAGCCAGGAAGGGAGGCGAACACAGCCACTGACCATGTAGCCAAACTGGTGATGACCCCATAAGTCAAGGTCCTTGCCCTCAAGGAAAACACCGCGTGCACAAT
>seq-317-5__IGL_UNSEG
GTGCAAGGATCAGAAGATAACGAAACGTCCACTTCCTGAAGGGTGGGAAAAAAAGAAAAAGAAAAAGGAGCCACCCACGCTGGAGATGTCCGTTTTAGATCTTCTTATTTTCTTCCCTTTCGCTTCGGTTTTTCTTCTCGAGGCTCA
>seq-317-6__TRD_UNSEG
GGTGTGACCGGGGCTTTGGTGGACCCTATTGTGTTCCTGTTGTTCCTCTGCCCTCGATTCTTAAAGACGATTTCAATGGGAATTTACATCCTGACCTTTGGCCTGAAGTGTATGGTGCAGAGA
>seq-317-7__TRD+_UNSEG
GTGGTGGTTCTGGTCCTGTTCAAATACAAGCGGCTCAGGTCCATGACTGATGTGTACCTGCTCAACCTTGCCATCTCGGATCTGCTCTTCGTGTTTTCCCTCCCTTTTTGGGGCTACTATGCAGCAGACCAGTGGGTTTTTGGGCTAGGTC
>seq-317-8__TRD+_UNSEG
GTTGCTTAAGATCAGTTGCTTTTATACTCAGAATGGAAATACCTGATCTTGGCTAGCTTTGTTTGTTA
>seq-317-9__IGK+_UNSEG
GGGCAGCAGCCCAGTCTTCCTACTGTCTGATTTAATTACAGCGGTTCCTGTGGGAGTGGGGGCTGTTATTCTCTTAAACATTTGCAGCTTGAAACAGTTGAGGAAGCAGCTTTAAAAAAAAAAAATCTCCCTACCCCCAACAA
>seq-317-10__IGH_UNSEG
GGGCAGAGAGTGCTGGGCTGAGTCGTATTGCTTTGCTAGACTTCCATAGGAATGGGCTTCTTGCGGCGAGAAAAGGGTGCCCCACCCTCTACTTGGACTACACTACTCTGAAACCTTGTGGCAGAGGCAGAGAAAAATCTGCTTTA
>seq-317-11__TRD+_UNSEG
AGCATACTCATCAGGCCAGTATTTGACACATTTACTCTTTCCTCTCTCCGCTTCTTTCATTGTCATGACAATCAGTCTGGAGTTTTGGAAAACCATCCGCCAAAAGTCGTTCACTGTGTTTTGTAGGCAGCCTTGTGTGGCAATGTAAC
>seq-317-12__TRD_UNSEG
AGGGAAACCTCAAGTGCTCGCAGAAGCATCGGCAAGTCAGGCGTCCTGTTTCTCGGATGGATACCCATTACCATCTTGGACCTGGAAGAAGTGTTCAGACAAGTCT
>seq-317-13__TRG_UNSEG
TGGATTCTGGTTTACAGCAGCTTTACAGTGATAGTTAAATTAACTGGGGCTAGGGGAAGAGCAAGCAAAAAGGGAAGAAGGACTCCTAGGCCCTTTCTAGTAAATCCTTCAGCAACAAGGCTGGCTTGGTGCCCTCCAAGCATCTAATG
>seq-317-14__TRG_UNSEG
ACCCTTTACCCTGATGATCTGTATTATATTTTAATGTATATGTGAATATATTGAAAATAATTTGTTTTTTCCTGGTTTTTGTTTGGTTTTCGTTTTGCTTTTAGCCTCTACATGCTAGGATCACAGGAAGACTTTGTAAGGACA
>seq-317-15__IGK_UNSEG
CATTTAATCTGATGTGGCATTTTCGTCATCTGAAGCATGAGTGACAAGTTGGGAATGATGTGGTGATTTAGAATGCAGTATTGGCCAAGTCCAAGTTGTCAACTTAAGCGTCTGTTTACCAAAGACCGGGAACAGGGGCCCAAACA
>seq-317-16__TRD+_UNSEG
TTTAGTTGTAGATTTCAATGGGATACGATAGGACAGAAAAGATTTTTTAAAAAGCAGAAAGAGTGTTTCATGGTGAAAGTACTGGGGGAGGGTGGACAAAGCATGCACACATGCCAATTTGAAAATCAAGTGTGACTTACCTCACGT
>seq-317-17__IGK+_UNSEG
CGGGATAGAGGGCAGTGGCACTATGAAAGTCAGCCATCTGGTGAGGCAGCAGCTGTCCGATGGCGTGGAACACAAGGCCCCCCACACGGAACATGTGCAGCCGTTCTCCCCGCTGAATGATGCTAGCGATTTGCTTCACCTCGTCC
>seq-317-18__IGK+_UNSEG
TGTCACCATTCACCTTGGACAGTGGGGCAGATTGGTTCCAATTGGGTTTCTCATCCTTGTCCACCGAAGATCCCTTTGTCACTGCAGCTTCTCTAGTGTCAGCCTCACTGCTGTCCTCCGTGAGGTGACCTTCAAAG
>seq-317-19__IGK+_UNSEG
CACCACTTTTAGTACCAACACTCTTGGGTGATTTCATGGACCCTAAAGCAGACCTGACACTGATCCAGATTTGCAGTCCATTTTTAAGGACACCTGTCTTTATTTCCTCAAAGTCAAGCAGCTTTCTCTGGAAAATGAATGCTAATTAGT
>seq-317-20__IGK+_UNSEG
AGACAGGATCAGGGACAGTCACATTAAAACACCATAGCACCATTTTATTTAGACTATTTCAATTCATAAAAATGCTTCCTAGTCCATAAAACACACTTCAGTAACAAAAGGAAAGAGATACTGGTTGAGGCACGTCAGGGATATCA
>seq-317-21__IGK+_UNSEG
GACCAGGGAGCTTGGTGAGCAGCCGGGGACTCTGGGAAGGGCTGAGAGCCAGCACAGCTGAGTGCTGTTGCTGTTGTTGCTGCTGCTGCTGCTGTTGTTGCTGCTGCTTGTTCCGATATTCTGCCATGAGATTAGTGTGCTCCTTC
>seq-317-22__IGK+_UNSEG
GTTTTATATCGTTGTAAAATAATTTTTCTAATTTTTTATAGGCTATGGATGAAATGAATGGCAAAGAAATAGAAGGGGAAGAAATTGAAATAGTCTTAGCCAAGCCACCAGACAAGAAAAGGAAAGAGCGCCAAGCTGCTAGACAGGCCTC
>seq-317-23__TRD_UNSEG
TTTTCAATGATCTAGATCAATACTTTGTTTCTCACCCATTTCATAATCAGTTTCTGCTACTCTCCTCATTTTGGGGGGTGTTGTGATCCCTGATTCCATTTCTTGCCTTTTAGGAGCCTTTGTGTCTGATATCAAGTGATCAAAA
>seq-317-24__TRG_UNSEG
ACTCCAGTCTGGGTGAAAGAGTGAGACCTTGTCTCAAAAAAGGAAGTGAAAGGTAATTAAAAAAGAACTTACGAAGGAAGGTCTTTGGCAGCTCTCAAGCCCCAGCCTTTCTTTTCTGTGAGTATGACTTCCACATCTGCATGCTGTTT
>seq-317-25__IGK_UNSEG
CTCTTTATTTGTCCCCTTGCCTCCCTTTCCAATGGACTATTTTAGAAGAAATGGAGCTGTCACCCACATCAAGATTCAGAACACTGGTGATTACTATGACCTGTATGGAGGGGAGAAATTTGCCACTTTGGCTGAGTTGGTCCAG
>seq-317-26__IGK+_UNSEG
GATGTGAAAGAAAGGGCGAAGGGTTTTTTGAGTTTTTGTTTTTGAGGAAGGGGAGTTGGGTACTTCTGCCTCTCCTAGCATGATAGGCATTCTCATAGCCAGGGACAGATTTTCTCCTGCAGCCCAGGGTGCTAAGCAGACATCTCTGGGA
>seq-317-27__IGK_UNSEG
CTCCATGGCACGAAAGGTCCTGGCTGTGATGGAGTCTCCTTCCTGAAATCCAATTTGTACCGGTCTCAACAGCAGGTCACTTCACCTGGACCCAGCTGAATCACCAGCTCCTTTTATGATATTTGTGTTTGTTTCACAATTTCTCAAGG
>seq-317-28__TRD+_UNSEG
AAGAGAACACACTTACTCTCCACGTCGCGGACACAGACGCCATAGAGGTACACGATGTGTTTGTGGGAGACCTGTCTCATCATGCTGGCTGCCTCGAAGAAGGCCTGTGGGCGAGCAGGACATAGGAATGTC
>seq-317-29__IGK+_UNSEG
GTCGGCGGCGTCGGCAGCAGTGTCGACGGCAGCGGCGGCGGCGGGTGGGAAATGGCGGAGTATCTGGCCTCCATCTTCGGCACCGAGAAAGACAAGTGAGTGGGAGCCCCCCGCCGGGGGTTGGGCGCGATCGGGGCGCAGGGTGGTTG
>seq-317-30__TRG_UNSEG
TGGTTGCTTGATAGGTAGGTACTCACCTATTCTCACAGATCTCCTTTTGTCGGCCTTGGTTGGGACAACATAAGAAACTCCAGGTTTCATGTCCATGTACTCATTAGTACTATCGCTGCTGGGAGAGATGAAACAAGTCATGAC
>seq-317-31__TRD+_UNSEG
TTGTCATAAATGCTTTTTGCTGTCACTCTAGTGGTTACTATCCTCTGCCTTCCTCTCCTCCCCTACTCCCCCAGAGAACCAAGGCGTCTGGGGGATTGACTGGGGGGCAGAGGGGGTTTCCCCAGCAAAATCAAACACCTGTCTCCAGAG
>seq-317-32__IGK+_UNSEG
ACAGCTACTATATTAGGAGGGATTCCATTTTCACAATTGCAAAACAGATATTTCAGGAACATGGGCCACAAAATGTACTCCTTTCACAGTGTTCTCCTCTTCTGAACTGTGCAGTTATCTATTAAATTTTC
>seq-317-33__TRD_UNSEG
GCACTCTGGGCCCGGACCGCCAACCAGCAGACCTGAACGTCCACATCAGACAGGATGGTTTTTCAATGGGAAGAAAACAAAGATGGCGACAGGAAGGAAACTGAGCAGGGAGGTATTTGTACTTTGGAGGTACAAGGGATCTACCCCA
>seq-317-34__IGK+_UNSEG
CTCGCGTTATGTGCGACGAGAACTCGTACCGGTCCTGGCTGTGGTAGCCGCACATGTTGCACTCAAAAGGATCACGGAAGCCGTGGCAGCCCATGTGGATGGTGTACATGACGTGATCCAGGAAGAGCACCCGGCAGTGTTCGCAC
>seq-317-35__TRB_UNSEG
CCCTGGGTCCTCCCCACATCCATGGTACTAGGAAGGAGAGTATCAAACCTGTTTGTAGGCTCTGAACCTTATGCTCAGCTTCCTCCAGCTTTGAGGTGGTGGACATCTGTGTCTCCTGCAGCTTTCTGCAAAGGAAGAG
>seq-317-36__IGK+_UNSEG
TGACCTTAAGAACTTTGTCTGGTGGCTTTGCTGGAACATTGTCACTGTTTTCACTGTCATGCAGGGAGCCCAGCACTGTGGCCAGGATGGCAGAGACTTCCTTGTCATCATGGAGAAGTGCCAGCAGGGGACTGGGAAAAGCACTCTAC
>seq-317-37__TRG_UNSEG
GCTGCTTCTCAGCAATGGCCTGAGAATTCACTTCTGTGCTACTAGTAGATGGAGGATTTGATACCTGTCCTTCAATGCTTACAGCTGGCTGGGAAAGCTGGGCAGAAAAAAAAGGGAAGTAGGTGAGACACACGCAGAGTCTGCCAAC
>seq-317-38__IGK+_UNSEG
GTGATAATCTTCATATGCAGTGCTTCTGGAGGCCTGTCTAGCAGCTTGGCGCTCTTTCCTTTTCTTGTCTGGTGCCTTGGCTAAGACTATTTCAAGTTCTTCCCCTTCTGTTTCTTTGCCATTCATTTCATCCATAGCCATAACAG
>seq-317-39__IGK+_UNSEG
TGCAGCTTTTGTTTTCTGTATGTTGTTGGGGGATCAACTTTCACACATAGCAAGCACATGGCCTCCCTGATGTCAGGATGCCTTTGTTAGGATCTGTATTTGCCCTTAATTTTGTTGAAATCTTTTTTCCTTCTTCCTCTTGAAAA
>seq-317-40__TRD_UNSEG
GAGGGCTGAGCTTCCCCTCAAACCTATCGAACATCTCATTGTGATTGGGGACATTTGACACACAGGTTCCTTGTGCAGCTTCAGAAAAAGAAATAGAGAGGAGAGATGCTTTGTTGGAATCATTCAAAACGAGGTCTATTCAACAC
>seq-317-41__IGK+_UNSEG
CACTATAAGACCGACTTCGACAAGAATAAGATCTGGTATGAGCACCGGCTCATTGATGACATGGTGGCTCAGGTCCTCAAGTCTTCGGGTGGCTTTGTGTGGGCCTGCAAGAACTATGACGGAGATGTGCAGTCAGACATC
>seq-317-42__IGL_UNSEG
GGACAGACCAGCCTCCATCCACAGCTCCCTTTAGGGCACCAAAAACTTTATTGCCAGCGGCAGTTCTGGCAAGCTCTGCATCCAAAGAGTAGACAAAGGCACCCAGCTGACCATCTATGCTCTCCACACTGTATTCATCGCCAGTC
>seq-317-43__TRD_UNSEG
ATCCAGGACTGCTCTGTTGGGCCTGGCTGGCCATGACTTGACCTGGGCCACCAACTCCCATATTGAGGTTAGGGGAACTACCAGATCGCAGCAATTCTGACAGCTGTTTATGTTTAGAAGCTGCATCTTGTACC
>seq-317-44__TRA_UNSEG
GTACTAGACAGTTTCATCAAAACCAGTGCAACAGGTGGCTTGGGATCAATAAAAGCTGAGGTGATGGCAGATACTGCTGTAGCTTTGGCTTCTGGAAATGTGAAATTGGTTTCAAGCAAGGTAATCACTTTTCTTTTGCCTTCTGTACTAT
>seq-317-45__TRD_UNSEG
AGCGAGAGTCCCTGCAGTCCCTTTCGACTTGCATTTTTGCAGGAGCAGTATCATGAAGCCTAAACGCGATGGATATATGTTTTTGAAGGCAGAAAGCAAAATTATGTTTGCCACTTTGCAAAGGAGCTCACTGTGGTGTCTGTGTTCC
>seq-317-46__IGK+_UNSEG
ACTTGAAGGCATCACTTTTAAGAAAGCTTACAGTTGGGCCCTGTACCATCCCAAGTCCTTTGTAGCTCCTCTTGAACATGTTTGCCATACTTTTAAAAGGGTAGTTGAATAAATAGCATCACCATTCTTTGCTGTGGCACAGG
>seq-317-47__IGH_UNSEG
ATCCAAGAGTAGCGCTCATGTTTTTTGACTCAAGAAAATAGGAAGTTTACTAACTGGCTTCCAGGAAAGGCCAAGGAGAGAAAGCCAATGGGAAGGAGGGTGGGGCAGAGGGACCCACACCAGGAAACCGCTGGCAGGTGGGGGATGGGCC
>seq-317-48__TRG_UNSEG
GCATTACCTTGCCTATTTTTAATATTATTAAAGCCTTTCTCCTTCAGTAGTCTATTTTCTTAGAATAACAACTCTTTTATCTATTCTGAACTCTATTTTTTTTCTTTTTTAAGAGACAAGGTTTTGCTCTGTTGCCCAGCTTGGACTCGAA
>seq-317-49__TRD_UNSEG
AAAAAAGCACAAAAATGGTCGGTGGGGAACCATATAACAAAACTACATCTCAGGCAGCTCTTTCTCAAGGAAGATTCTAAGATTTTATTATGTGGCTAATTCTAAATTGGAAATGGAACATGCTGGTATGTGAAGCAATTGGTGCTAGGA
>seq-317-50__IGL_UNSEG
CCTCCAGCTGGTGTTGGGAGCTTCTTCTTCTTCTCCTTGGGTGGTCTGTCTGGAAGCCGTGGGACAGGTGAACTTGGTGGGGGCCACCAGCCAGGAGCAGAAGGCTCTGAAGGAGCAGGGAAGGAGGTGTCGTGCACCTGTTCTAGGA
>seq-317-51__IGK+_UNSEG
GGGCTGGAGTTTCCTGTCAGCCTGTAACTGACCTTGGCACCTGCTTTCCTCCTCCAGAAGAGAAGAATCCCTACAAAGAAGTGTACACGGACATGTGGGTGGAACCTGAGGCAGCTGCCTACGCACCACCTCCACCAGCCAAAAAGC
>seq-317-52__TRD_UNSEG
CTGTTAACTACTGTACAACCCGACTTCATAATGGTGCTTTCAAACAGCGAGATGAGTAAAAACATCAGCTTCCACGTTGCCTTCTGCGCAAAGGGTTTCACCAAGGATGGAGAAAGGGAGACAGCTTGCAGATGGCGCGT
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment