Attention une mise à jour du serveur va être effectuée le lundi 17 mai entre 13h et 13h30. Cette mise à jour va générer une interruption du service de quelques minutes.

Commit 93d824ff authored by Mathieu Giraud's avatar Mathieu Giraud

Merge branch 'feature-c/update_tests_with_germline_2021' into 'dev'

qunit; update some tests with germline sequence

Closes #4749

See merge request !936
parents c683567b 5bab0401
Pipeline #234928 failed with stages
in 9 minutes
......@@ -478,7 +478,7 @@ QUnit.test("findGermlineFromGene", function(assert) {
gene3a_name = "IGHJ6*01"
gene3a_seq = "......attactactactactacggtatggacgtctgggggcaagggaccacggtcaccgtctcctcag"
gene3b_name = "TRGJ1*02"
gene3b_seq = "...................ttattataagaaactctttggcagtggaacaacacttgttgtcacag"
gene3b_seq = "................gaattattataagaaactctttggcagtggaacaacacttgttgtcacag"
var getted = m.findGermlineFromGene(gene5_name)
assert.equal(getted, gene5_seq, 'function return the correct sequence for the gene V: IGHV1-18*01')
......
......@@ -210,15 +210,15 @@ QUnit.test("segt", function (assert) {
segment.update();
m.select(2)
segment.addGermlineToSegmenter("IGHD1-1*01","IGH");
assert.equal(segment.sequence["IGHD1-1*01"].seq.join("").toUpperCase(), "GGGCGCCGGGGCAGATTCTGAACAGCCCCGAGTCACGGTGGGTACAACTGGAACGAC")
assert.equal(segment.sequence["IGHD1-1*01"].is_clone, false);
assert.equal(segment.sequence["IGHD1-1*01"].seq.join("").toUpperCase(), "CCAGGAGGCCCCAGAGCTCAGGGCGCCGGGGCAGATTCTGAACAGCCCCGAGTCACGGTGGGTACAACTGGAACGAC", "seq.join IGHD1-1*01")
assert.equal(segment.sequence["IGHD1-1*01"].is_clone, false, "segment sequence is_clone");
segment.addToSegmenter(2);
segment.add_all_germline_to_segmenter();
// segment.updateElem()
assert.equal(segment.sequence[2].seq.join(" "),"c c c c c c c c c c c c c c c c c c c c", "clone 3 sequence")
assert.equal(segment.sequence["IGHV1-2*01"].seq.join("").toLowerCase(),"caggtgcagctggtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacaccttcaccggctactatatgcactgggtgcgacaggcccctggacaagggcttgagtggatgggacggatcaaccctaacagtggtggcacaaactatgcacagaagtttcagggcagggtcaccagtaccagggacacgtccatcagcacagcctacatggagctgagcaggctgagatctgacgacacggtcgtgtattactgtgcgagaga","5 germline")
assert.equal(segment.sequence["IGHD2-2*02"].seq.join("").toUpperCase(),"GCGGGGACAGGAGGATTTTGTGGGGGCTCGTGTCACTGTGAGGATATTGTAGTAGTACCAGCTGCTATACC","4 germline")
assert.equal(segment.sequence["IGHJ6*01"].seq.join("").toLowerCase(),"attactactactactacggtatggacgtctgggggcaagggaccacggtcaccgtctcctcagaagaatggccactctagggcctttgttttctgctactgcc","3 germline")
assert.equal(segment.sequence["IGHV1-2*01"].seq.join("").toLowerCase(),"caggtgcagctggtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacaccttcaccggctactatatgcactgggtgcgacaggcccctggacaagggcttgagtggatgggacggatcaaccctaacagtggtggcacaaactatgcacagaagtttcagggcagggtcaccagtaccagggacacgtccatcagcacagcctacatggagctgagcaggctgagatctgacgacacggtcgtgtattactgtgcgagaga","5 germline (IGHV1-2*01)")
assert.equal(segment.sequence["IGHD2-2*02"].seq.join("").toUpperCase(),"GAGGGGACTCAGTGACTCCCGCGGGGACAGGAGGATTTTGTGGGGGCTCGTGTCACTGTGAGGATATTGTAGTAGTACCAGCTGCTATACC","4 germline (IGHD2-2*02)")
assert.equal(segment.sequence["IGHJ6*01"].seq.join("").toLowerCase(),"attactactactactacggtatggacgtctgggggcaagggaccacggtcaccgtctcctcagaagaatggccactctagggcctttgttttctgctactgcctgtggggtttcctgagcatt","3 germline (IGHJ6*01)")
segment.addSequenceTosegmenter("test","igh", "accccccgtgtagtagtcc")
assert.equal(segment.sequence["test"].seq.join("").toLowerCase(),"accccccgtgtagtagtcc"," test sequence ")
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment