Commit 9387e03a authored by Mikaël Salson's avatar Mikaël Salson Committed by Mathieu Giraud

Vidjil: release 2013.04

	* First public release
parent ce297076
all:
make -C src
test: all
make -C src/tests
make should
should: all
@echo
@echo "*** Launching .should_get tests..."
src/tests/should-to-tap.sh src/tests/stanford.should_get
src/tests/should-to-tap.sh src/tests/clones_simul.should_get
src/tests/should-to-tap.sh src/tests/clones_simul_cluster.should_get
src/tests/should-to-tap.sh src/tests/segment_S22.should_get
src/tests/should-to-tap.sh src/tests/segment_lec.should_get
src/tests/should-to-tap.sh src/tests/segment_simul.should_get
@echo "*** All .should_get tests passed"
data germline: %:
make -C $@
clean:
make -C src clean
cleanall: clean
make -C data $^
make -C germline $^
.PHONY: all test should clean cleanall distrib data germline
RELEASE_TAG="notag"
RELEASE_H = src/release.h
RELEASE_SOURCE = $(wildcard src/*.cpp) $(wildcard src/*.h) $(wildcard src/core/*.cpp) $(wildcard src/tests/*.cpp) $(wildcard src/core/*.h) $(wildcard src/tests/*.h)
RELEASE_MAKE = ./Makefile src/Makefile src/tests/Makefile germline/Makefile data/Makefile
RELEASE_TESTS = data/get-sequences $(wildcard data/*.fa) $(wildcard data/*.fq) src/tests/should-to-tap.sh $(wildcard src/tests/*.should_get) $(wildcard src/tests/bugs/*.fa)
RELEASE_FILES = $(RELEASE_SOURCE) $(RELEASE_TESTS) $(RELEASE_MAKE) germline/get-germline germline/split-from-imgt.py doc/README doc/LICENSE
RELEASE_ARCHIVE = vidjil-$(RELEASE_TAG).tgz
CURRENT_DIR = vidjil
DIST_DIR=$(CURRENT_DIR)-$(RELEASE_TAG)
RELEASE_FILES_VID = $(RELEASE_FILES)
# make distrib RELEASE_TAG=2013.04alpha
distrib:
$(info ==== Release $(RELEASE_TAG) ====)
# Tag the release
if test "$(RELEASE_TAG)" != "notag"; then \
git tag -f release-$(RELEASE_TAG); \
echo '#define RELEASE_TAG "$(RELEASE_TAG)"' > $(RELEASE_H); \
fi
mkdir -p release
rm -rf release/$(RELEASE_ARCHIVE) release/$(DIST_DIR)
mkdir -p release/$(DIST_DIR)
for file in $(RELEASE_FILES_VID); do\
dir=release/$(DIST_DIR)/`dirname "$$file"`; \
mkdir -p $$dir; \
cp "$$file" $$dir; \
done
cd release && tar cvzf $(RELEASE_ARCHIVE) $(DIST_DIR) \
&& rm -rf $(DIST_DIR)
# Untag the source
rm -f $(RELEASE_H) ; touch $(RELEASE_H)
# Check archive
cd release && tar xvfz $(RELEASE_ARCHIVE)
cd release/$(DIST_DIR) && make
cd release/$(DIST_DIR) && make germline
cd release/$(DIST_DIR) && make data
cd release/$(DIST_DIR) && make test
DATA=Stanford_S22.fasta
$(DATA):
sh get-sequences
clean:
$(RM) -f $(DATA)
\ No newline at end of file
# 100 reads (200bp) from 2 first clones of S22, should be 50%/50%
# exact
wgsim -S42 -N100 -e0 -d0 -1 200 -2 1 -h clones_simul.fa.base clones_simul_exact.fa /dev/null
# some errors
wgsim -S42 -N100 -e0.01 -d0 -1 200 -2 1 -h clones_simul.fa.base clones_simul.fa /dev/null
@clone1_20_219_2:0:0_0:0:0_0/1
CATTAGTAGTAATAGTGGTGCCATATACTACGCAGACTGTGTGAAGGGCCGATTCACCATCTCCAGAAACAATGCCAAGGACTCACTGAATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGCGATCCCCCGGTATTACTATGATACTAGTGGCCCAAACGACTACTGGGGCCAGG
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_3_202_0:0:0_1:0:0_1/1
TTTGGGCCACTAGTATCATAGTAATACCGGGGGATCTCTCTCGCACAGTAATACACAGCCGTGTCCTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTCCTTGGCATTGTTTCTGGAGATGGTGAATCGGCCCTTCACAGAGTCTGCGTAGTATATGGCACCACTATTACTACTAATGTATGAAACCCACTCCAG
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_7_206_0:0:0_3:0:0_2/1
GTCGTTTGGGCCACTAGTATCATAGTAATACCGGGGGATCGCTGTCGCACAGTAATCCACAGCCGTGTCCTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTCCTTGGCATTGTTTCTGGAGATGGTGAATCGGCCCTTCACAGAGTCTGCGTAGTATATGGCACCACTCTTACTACTAATGTATGAAACCCACT
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_8_207_1:0:0_0:0:0_3/1
GTGGGTTTCATACATTAGTAGTAATAGTGGTGCCATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAAACAATGCCAAGGACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCTAGAGCGATCCCCCGGTATTACTATGATACTAGTGGCCCAAACGACT
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_30_229_0:0:0_3:0:0_4/1
ACCAGGGTTCCCTGGCCCCAGTAGTCGTTTGTGCCACTAGTATCATAGTAATACCGGGGGATCGCTCTCGCACAGTAATACACAGCCGTGTCCTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTCCTTGTCATTGTTTCTGGAGATTGTGAATCGGCCCTTCACAGAGTCTGCGTAGTATATGGCACCACTATT
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_16_215_0:0:0_3:0:0_5/1
GCCCCAGTAGTCGTTTGGGCCACTAGTATCATAGTAATACCGGGGGATCGCTCTCGCACAGTAATACACAGCCGTGTCCTGGGCTCTCAGGCTGTTCATTTGCAGATACAGTTAGTCCTTGGCATTGTTTCTGTAGATGGTGAATCGGCCCTTCACAGAGTCTGCGTAGTATATGGCACCACTATTACTACTAATGTATG
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_31_230_0:0:0_1:0:0_6/1
GACCAGGGTACCCTGGCCCCAGTAGTCGTTTGGGCCACTAGTATCATAGTAATACCGGGGGATCGCTCTCGCACAGTAATACACAGCCGTGTCCTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTCCTTGGCATTGTTTCTGGAGATGGTGAATCGGCCCTTCACAGAGTCTGCGTAGTATATGGCACCACTAT
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_38_237_2:0:0_0:0:0_7/1
TGCCATATACTACGCAGACTCTGTGAAGTGCCGATTCACCATCTCCAGAAACAATGCCAAGGACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATAACTGTGCGAGAGCGATCCCCCGGTATTACTATGATACTAGTGGCCCAAACGACTACTGGGGCCAGGGAACCCTGGTCACCGTCT
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_13_212_0:0:0_1:0:0_8/1
CCAGTAGTCGTTTGGGCCACTAGTATCATAGTAATACCGGGGGATCGCTCTCGCACAGTAATACACAGCCGTGTCCTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTCCTTGGCATTGTTTCTGGAGATGGTGAATCGGCCCTTCACAGAGTCTGCGTAGTATATGGCACCACTATTACTACTAATGTATGCAA
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_18_217_0:0:0_3:0:0_9/1
TGGCCCCAGTAGTCGTTTGGGCCACTAGTATCATAGTAATACCGGGGGAACGCTCTCGCACAGTAATACACAGCCGTGTCCTCGGCTCTCAGGCTGATCATTTGCAGATACAGTGAGTCCTTGGCATTGTTTCTGGAGATGGTGAATCGGCCCTTCACAGAGTCTGCGTAGTATATGGGACCACTATTACTACTAATGTA
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_43_242_3:0:0_0:0:0_a/1
TATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAAACAATGCCAAGGACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGATAGCGATCCCGCGGTATTACTATGATACTAGTGGCCCAAACGACTACTGGGGCCAGGGAACCCTGGTGACCGTCTCCTCA
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_19_218_0:0:0_1:0:0_b/1
CTGGCCCCAGTAGTCGTTTGGGCCACTAGTATCATAGTAATACCGGGGGATCGCTCTCGCACAGTAATACACAGCCGTGTCCTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTCCTTGGCATTGTTTCTGGAGATGGTGAATCGGCCCTTCACAGAGTGTGCGTAGTATATGGCACCACTATTACTACTAATGT
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_27_226_1:0:0_0:0:0_c/1
AGTAATAGTGGTGCCATATACAACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAAACAATGCCAAGGACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGCGATCCCCCGGTATTACTATGATACTAGTGGCCCAAACGACTACTGGGGCCAGGGAACCCT
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_42_241_0:0:0_4:0:0_d/1
GAGGAGACGGTGACCAGGGTTCCCTGGCCCCAGTCGTCGTTTGGGCCACTAGTATCATAGTAATACCGGGGGATCGCTCTCGCACAGTAATACACAGCCGTGTCCTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTCCTTGGCATTTTTTCTGGAGATGGTGAATCGGCCCTTCACAGAGTCTGGGTAGTATAA
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_20_219_0:0:0_3:0:0_e/1
CGTGGCCCCAGTAGTCGTTTGGGCCACTAGTATCCTAGTAATACCGGGGGATCGCTCTCTCACAGTAATACACAGCCGTGTCCTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTCCTTGGCATTGTTTCTGGAGATGGTGAATCGGCCCTTCACAGAGTCTGCGTAGTATATGGCACCACTATTACTACTAATG
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_37_236_1:0:0_0:0:0_f/1
GTGCCATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAAACAATGCCAAGGACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGCGATCCCCCGGTATTACTATGATACTAGTGGCCCAAACGACTACTGGGGCGAGGGAACCCTGGTCACCGTC
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_28_227_3:0:0_0:0:0_10/1
GTAATAGTGGTGCCATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAACCAATGCCAAGGACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGCGATCCCCCGGTATTACTATGATACTAGTGGCCCAAACGAGTACTTGGGCCAGGGAACCCTG
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_11_210_1:0:0_0:0:0_11/1
GGTTTCATACATTAGTAGTAATAGTGGTGCCATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAAACAATGCCAAGGACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGCGATCCCCCGGTATTACTATGATACTAGTGGCCCCAACGACTACT
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_12_211_1:0:0_0:0:0_12/1
GTTTCATACATTAGTAGTAATAGTGGTGCCATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAAACAATGCCACGGACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGCGATCCCCCGGTATTACTATGATACTAGTGGCCCAAACGACTACTG
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_11_210_0:0:0_1:0:0_13/1
AGTAGTCGTTTGGGCCACTAGTATCATAGTAATACCGGGGGATCGCTCTCGCACAGTAATACACAGCCGTGTCCTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTCCTTGGCATTGATTCTGGAGATGGTGAATCGGCCCTTCACAGAGTCTGCGTAGTATATGGCACCACTATTACTACTAATGTATGAAACC
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_3_202_0:0:0_1:0:0_14/1
TTTGGGCCACTAGTATCATAGTAATACCGGGGGATCGCTCTCGCACAGTAATACACAGCCGTGTCCTCGGCTCTCAGGCTGTTCATTTGGAGATACAGTGAGTCCTTGGCATTGTTTCTGGAGATGGTGAATCGGCCCTTCACAGAGTCTGCGTAGTATATGGCACCACTATTACTACTAATGTATGAAACCCACTCCAG
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_14_213_1:0:0_0:0:0_15/1
TTCATACATTAGTAGTAATAGTGGTGCCATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAAACAATGCCAAGGACTCACTGAATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGCGATCCCCCGGTATTACTATGATACTAGTGGCCCAAACGACTACTGGG
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_24_223_3:0:0_0:0:0_16/1
AGTAGTAATAGTGGTGCCATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAAACAATGCCAAGGACTCACTGTATCTGCAAATGAACCGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGCTATCCCCCTGTATTACTATGATACTAGTGGCCCAAACGACTACTGGGGCCAGGGAAC
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_12_211_1:0:0_0:0:0_17/1
GTTTCATACATTAGTAGTAATAGTGGTGCCATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAAACAATGCCAAGGACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGGTGTGTATTACTGTGCGAGAGCGATCCCCCGGTATTACTATGATACTAGTGGCCCAAACGACTACTG
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_25_224_0:0:0_1:0:0_18/1
GGTTCCCTGGCCCCAGTAGTCGTTTGGGCCACTAGTATCATAGTAATACCGGGGGATCGCTCTCGCACAGTAATACACAGCCGTGTCCTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTCCTTGGCATTGTTTCTGGAGATGGTGAATCGGCCCTTCACAGAGTCTGCGTAGTATATGGCACCACTAATACTAC
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_4_203_0:0:0_2:0:0_19/1
GTTTGGGCCACTAGTATCATAGTAATACCGGGGGATCGCTCTCGCACAGTAATACACAGCCGTGTCCTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTCCTTGGCATTGTTTCTGGCGATGGTGAATCGGCCCTTCACAGAGTCTGCGTAGTATATGGCACCACTATTACTACTAATTTATGAAACCCACTCCA
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_11_210_7:0:0_0:0:0_1a/1
GGTTTCATACATTAGTAGTAAAAGTGGTGCCATCTACTACGCAGACTCTGTGAAGGGCCTATTCACCATCTCCAGAAACAATGCCAAGGACTCAGTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTAATACTGTGCGAGAGCGATCCCCCGGTATTACTATGATACTATTGGGCCAAACGACTACT
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_8_207_2:0:0_0:0:0_1b/1
GTGGGTTTCATACATTAGTAGTAATATTGGTGCCATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAAACAATGCCAAGGACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATAACTGTGCGAGAGCGATCCCCCGGTATTACTATGATACTAGTGGCCCAAACGACT
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_19_218_0:0:0_0:0:0_1c/1
CTGGCCCCAGTAGTCGTTTGGGCCACTAGTATCATAGTAATACCGGGGGATCGCTCTCGCACAGTAATACACAGCCGTGTCCTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTCCTTGGCATTGTTTCTGGAGATGGTGAATCGGCCCTTCACAGAGTCTGCGTAGTATATGGCACCACTATTACTACTAATGT
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_19_218_0:0:0_2:0:0_1d/1
CTGGCCCCAGTAGTCGTTTGGGCCACTAGTATCATAGTAATACCGGGGGATCGCTCTCGCACAGTAATACACAGCCGTGTCCTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTCCTTGGCATTGTTTCTGGAGATGGTGAATCGGCCCTTCACAGAGTCTGCGTAGTATATGGCACGACTATTACTACTAATTT
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_10_209_0:0:0_6:0:0_1e/1
GTAGTCGTTTGGGCCACTCGTATCATAGTAATACCGGGGGATCGCTCACGCACAGTAATAGACAGCCGTGTCCTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTCCTTGGCATTGTTTCTGGAGATGTTGAATCGGCCCTTCACAGAGTCTGCGTAGTATATGGCACCACTATTACTACTAATGTATGAAAGGC
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_2_201_0:0:0_0:0:0_1f/1
GCTGGAGTGGGTTTCATACATTAGTAGTAATAGTGGTGCCATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAAACAATGCCAAGGACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGCGATCCCCCGGTATTACTATGATACTAGTGGCCCAA
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_15_214_2:0:0_0:0:0_20/1
TCATACATTAGTAGTAATAGTGGTGCCATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAAACAATGCCAAGGACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGAGCGAGAGCGATCCCCCGGTATTACTATGATACTAGTGGCCCAAACGACTACAGGGG
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_34_233_3:0:0_0:0:0_21/1
GTGGAGCCATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAAACAATGCCAAGGACTCAGTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGCGATCCCCCGGTATTACTATGATACTAGTGGCCCAAACGACTACTGGTGCCAGGGAACCCTGGTCACC
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_36_235_0:0:0_1:0:0_22/1
ACGGTGACCAGGGTTCCCTGGCCCCAGTAGTCGTTTGGGCCACTAGTATCATAGTAATACCGGGGGATCGCTCTCGCACAGTAATACACAGCCGTGTCCTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTCCTTGGCATTGTTTCTGGAGATGGTGAATCGGCCCTTCCCAGAGTCTGCGTAGTATATGGCACC
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_35_234_0:0:0_0:0:0_23/1
TGGTGCCATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAAACAATGCCAAGGACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGCGATCCCCCGGTATTACTATGATACTAGTGGCCCAAACGACTACTGGGGCCAGGGAACCCTGGTCACCG
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_3_202_0:0:0_0:0:0_24/1
CTGGAGTGGGTTTCATACATTAGTAGTAATAGTGGTGCCATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAAACAATGCCAAGGACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGCGATCCCCCGGTATTACTATGATACTAGTGGCCCAAA
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_34_233_2:0:0_0:0:0_25/1
GTGGTGCCATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAAACAATGCCAAGGACTCACTGTATCTGCAAATTAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGCGATCCCCCGGTCTTACTATGATACTAGTGGCCCAAACGACTACTGGGGCCAGGGAACCCTGGTCACC
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_43_242_3:0:0_0:0:0_26/1
TATACTACGCAGACTCTGTGAAGGGCCGATTCACGATCTCCAGAAACAATGCCAAGGACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGAGTATTACTGTGCGAGAGCTATCCCCCGGTATTACTATGATACTAGTGGCCCAAACGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCA
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_16_215_0:0:0_3:0:0_27/1
GCCCCAGTAGTCGTTAGGGCCCCTAGTATCATAGTAATACCGGGGGATCGCTCTCGCACAGTAATACACAGCCGTGTCCTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTCCTAGGCATTGTTTCTGGAGATGGTGAATCGGCCCTTCACAGAGTCTGCGTAGTATATGGCACCACTATTACTACTAATGTATG
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_34_233_2:0:0_0:0:0_28/1
GTGGTGCGATATACTACTCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAAACAATGCCAAGGACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGCGATCCCCCGGTATTACTATGATACTAGTGGCCCAAACGACTACTGGGGCCAGGGAACCCTGGTCACC
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_31_230_4:0:0_0:0:0_29/1
ATAGTGGTGCCATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAAACAATGCCAAGGACTCACTGTATCTGCAAATGAACAGCGTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGCGATCGCCCGGTATTACTATGATAGTAGTGGCCCAAACGACTACTGGGGCCAGGGAACCCTGTTC
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_43_242_0:0:0_1:0:0_2a/1
TGAGGAGACGGTGACCAGGGTTCCCTGGCCCCAGTAGTCGTTTGGGCCACTAGTATCATAGTAATACCGGGGGATCGCTCTCGCACAGTAATACACAGCCGTGTCCTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTCCTTGGCATTGTTTCTGGAGATGGTGAATCGGCCCTTCACCGAGTCTGCGTAGTATA
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_43_242_0:0:0_0:0:0_2b/1
TGAGGAGACGGTGACCAGGGTTCCCTGGCCCCAGTAGTCGTTTGGGCCACTAGTATCATAGTAATACCGGGGGATCGCTCTCGCACAGTAATACACAGCCGTGTCCTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTCCTTGGCATTGTTTCTGGAGATGGTGAATCGGCCCTTCACAGAGTCTGCGTAGTATA
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_40_239_0:0:0_1:0:0_2c/1
GGAGACGGTGACCAGGGTTCCCTGGCCCCAGTAGTCGTTTGGGCCACTAGTATCATAGTAATACCGGGGGATCGCTCTCGCACAGTAATACACAGCCGTGTCCTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTGCTTGGCATTGTTTCTGGAGATGGTGAATCGGCCCTTCACAGAGTCTGCGTAGTATATGG
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_22_221_0:0:0_3:0:0_2d/1
TCCCTGGCCCCAGTAGTCGTTTGGGCCACTAGTATCATAGTAATACCGGTGGATCGCTCTCGCACAGTCATACAGAGCCGTGTCCTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTCCTTGGCATTGTTTCTGGAGATGGTGAATCGGCCCTTCACAGAGTCTGCGTAGTATATGGCACCACTATTACTACTAA
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_19_218_3:0:0_0:0:0_2e/1
ACAATAGTAGTAATAGTGGTGCCATATACTACGCAGACACTGTGAAGGGCCGATTCACCATCTGCAGAAACAATGCCAAGGACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGCGATCCCCCGGTATTACTATGATACTAGTGGCCCAAACGACTACTGGGGCCAG
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_1_200_2:0:0_0:0:0_2f/1
GGCTGGAGTGGGTTTCATACATTAGTAGTAATAGTGGTGCCATATACTACGCAGACTCTGTGAAGGGCCTATTCACCATCTCCAGAAACAATGCCACGGACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGCGATCCCCCGGTATTACTATGATACTAGTGGCCCA
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_36_235_6:0:0_0:0:0_30/1
GGTGCCATATAGTAGGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAAACAATGCCAAGGAGTGACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGCGATCCCCCGGTATTACTATGATACTAGTGTCCCAAACGACTACTGGGGCCAGGTAACCCTGGTCACCGT
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_14_213_0:0:0_0:0:0_31/1
TTCATACATTAGTAGTAATAGTGGTGCCATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAAACAATGCCAAGGACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGCGATCCCCCGGTATTACTATGATACTAGTGGCCCAAACGACTACTGGG
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone1_7_206_3:0:0_0:0:0_32/1
AGTGGGTTTGATACATTAGTAGTAATAGTGGTGCCATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAAACAATGCCACGGACACACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGCGATCCCCCGGTATTACTATGATACTAGTGGCCCAAACGAC
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_34_233_0:0:0_1:0:0_0/1
CTGCGGAGACGGTGACCATTGTCCCTTGGCCCCAGATAATCAAAAGCATCAGACCAGCTGCTGCCCACTCTCGCACAGTAATACACAGCCGTGTCTTCAGATCTCAGGCTGCTCAGCTCCATGTAGGCTGTGCTCGCGGATGTGTCCCTGGTAATGGTGACTCTGCCCTGGAACTTCTGTGAATATTTTGTGTTACCATT
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_12_211_5:0:0_0:0:0_1/1
TATGGGATGGATCAACGCTGGCAATGGTAAGACAAAATATTCACAGAAGTTCCAGGTCAGAGTCACCATTACCAGGGACACATCCGCGAGCACCGCCTACATGGAGCTGAGCAGCCTGAGATCAGAAGACACGGCTGTGTATTACTGTGCGAGAGTGGGCAGCAGCTGGTCTGATGCTTTTGATTATCTGGGGCCAAGGG
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_23_222_0:0:0_3:0:0_2/1
GTGACCATTGTCCCTTGGCCCCAGATAATCAAAAGCATCAGACCAGCTGCTGCCCACTCTCGCACAGTAATACACAGCGGTGTCTTCAGATCTCAGGCTGCTCAGGTCCATGTAGGCTGTGCTCGCGGATGTGTCCCTGGTAATGGTGACTCTGCCCTGGAACTTCTGTGAATATTTTGAGTTACCATTGCCAGCGTTGA
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_26_225_4:0:0_0:0:0_3/1
ACGCTGGCAATGGTAACACAAAATATTCACAGAAGTTCCAGGGCATAGTCACCATTACCAGGGACACATCCGCGAGCACAGCCTACAAGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCTGTGTATTACTGTGCGAGAGTGGGCAGCCGCTGGTCTGATGCTTTTGCTTATCTGGGGCCAAGGGACAATGGTCACCGT
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_26_225_0:0:0_2:0:0_4/1
ACGGTGACCATTGTCCCTTGGCCCCAGATAATCAAAAGCATCAGACCAGCTGCTGCCCACTCTCGCACAGTAATACACAGCCGTGTCTTCAGATCTCAGGCTGCTCAGCTCCATGTAGGCTGTGCTCGCGGATGTGTCCCTGGTAATGGTGACTCTGCGGTGGAACTTCTGTGAATATTTTGTGTTACCATTGCCAGCGT
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_7_206_0:0:0_2:0:0_5/1
GGCCCCAGATAATCAAAAGCATCAGACCAGCTGCTGCCCAGTCTCGCACAGTAATACACAGCCGTGTCTTCAGATCTCAGGCTGCTCAGCTCCATGTAGGCTGTGCTCGCGGATGTGTCCCTGGTAATGGTGCCTCTGCCCTGGAACTTCTGTGAATATTTTGTGTTACCATTGCCAGCGTTGATCCATCCCATCCACTC
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_1_200_1:0:0_0:0:0_6/1
AGGCTTGAGTGGATGGGATGGATCAACGCTGGCAATGGTAACACAAAAAATTCACAGAAGTTCCAGGGCAGAGTCACCATTACCAGGGACACATCCGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCTGTGTATTACTGTGCGAGAGTGGGCAGCAGCTGGTCTGATGCTTTTGATTATCT
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_26_225_0:0:0_0:0:0_7/1
ACGGTGACCATTGTCCCTTGGCCCCAGATAATCAAAAGCATCAGACCAGCTGCTGCCCACTCTCGCACAGTAATACACAGCCGTGTCTTCAGATCTCAGGCTGCTCAGCTCCATGTAGGCTGTGCTCGCGGATGTGTCCCTGGTAATGGTGACTCTGCCCTGGAACTTCTGTGAATATTTTGTGTTACCATTGCCAGCGT
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_30_229_1:0:0_0:0:0_8/1
TGGCAATGGTAACACAAAATATTCACAGAAGTTCCAGGGCAGAGTCACCATTACCAGGGACACATCCGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGATATCTGAAGACACGGCTGTGTATTACTGTGCGAGAGTGGGCAGCAGCTGGTCTGATGCTTTTGATTATCTGGGGCCAAGGGACAATGGTCACCGTCTCC
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_22_221_3:0:0_0:0:0_9/1
ATCAACGCTGGCAATGGTAACACCAAATATTCACAGAAGTTCCAGGGCAGAGTCACCATTACCAGGGACACATCCGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTTAATACACGGCTGTGTATTACTGTGCGAGAGTGGGCAGCAGCTGGTCTGATGCTTTTGATTATCTGGGGCCAAGGGACAATGGTCA
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_28_227_0:0:0_2:0:0_a/1
AGACGGTGACCATTGTCCCTTGGCCCCAGATAATCAAAAGCATCAGACCCGCTGCTGCCCACTCTCGCACAGTAATACACAGCCGTGTCTTCAGATCTCAGGCTGCTCAGCTCCATGTAGGCTGTGCTCGCGGATGTGTCCCTGGTAATGGTGACTCTGCCCTGGCACTTCTGTGAATATTTTGTGTTACCATTGCCAGC
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_13_212_0:0:0_2:0:0_b/1
TCCCTTGGCCCCAGATAATCAAAAGCATCAGACCAGCTGCTGCCCACTCTCGCACAGTAATACACAGCCGTGTCTTCAGATCTCAGGCTGCTCAGCTCCATGTAGGCTGTGCTCGCGGATGTGTCCCTTGTAATGGTGACTCTGCCCTGGAACTTCTGTGAATATTTTGTGTTACCATAGCCAGCGTTGATCCATCCCAT
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_7_206_0:0:0_0:0:0_c/1
GAGTGGATGGGATGGATCAACGCTGGCAATGGTAACACAAAATATTCACAGAAGTTCCAGGGCAGAGTCACCATTACCAGGGACACATCCGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCTGTGTATTACTGTGCGAGAGTGGGCAGCAGCTGGTCTGATGCTTTTGATTATCTGGGGCC
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_27_226_0:0:0_2:0:0_d/1
GACTGTGACCATTGTCCCTTGGCCCCAGATAATCAAAAGCATCAGACCAGCTGCTGCCCACTCTCGCACAGTAATACACAGCCGTGTCTTCAGATCTCAGGCTGCTCAGCTCCATGTAGGCTGTGCTCGCGGATGTGTCCCTGGTAATGGTGACTCTGCCCTGGAACTTCTGTGAATATTTTGTGTTCCCATTGCCAGCG
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_21_220_4:0:0_0:0:0_e/1
GATCAACGCTGGCAATGGAAACACAAAATATTCACAGAAGTTCCAGGGCAGAGTCACCATTACCAGGGACACATCCGCGAGCACAGCCTACATGTAGCTGAGCAGCCTGAGATCTGAAGACACGGCAGTGTATTACTGTGCGAGAGTGGGCAGCAGCTGGTCTGATGCTTTTGATTATCTGGGGCCAAGTGACAATGGTC
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_15_214_1:0:0_5:0:0_f/1
TGACCCTTGGCCCCAGATAATCAAAAGCATCAGACCAGCTGCTGCCCACTCTCGCACAGTAATACACAGCCGTGTCTTCAGATCTGAGGCTGCTCAGCTCCATGTAGGCTGTGCTCGCGGATGTGTCCCTGGTAATGTTGACTCTGCCCTTGAACTTCTGTTAATATTTTGTGTTACCATTGCCAGCGTTGATCCATCCC
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_1_200_2:0:0_0:0:0_10/1
AGGCTTGAGTGGATGGGATGGATCAACGCTGGCAATGGTAACACAAAATATTCACAGAAGTTCCAGGGCAGAGTCACCATTACCAGGGACACATCGGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCTGAGTATTACTGTGCGAGAGTGGGCAGCAGCTGGTCTGATGCTTTTGATTATCT
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_8_207_1:0:0_0:0:0_11/1
AGTGGATGGGATGGATCAACGCAGGCAATGGTAACACAAAATATTCACAGAAGTTCCAGGGCAGAGTCACCATTACCAGGGACACATCCGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCTGTGTATTACTGTGCGAGAGTGGGCAGCAGCTGGTCTGATGCTTTTGATTATCTGGGGCCA
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_9_208_5:0:0_0:0:0_12/1
GAGGATGGGATGGATCAACGCTGGCAATGGTAACACAAAATATTCACAGAAGTTCCAGGGCAGAGTCACCATTACCAGTTACACATCCGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCTGTGTATTACTGTGCGAGAGTGGGGAGCAGCTGGTCTGATGCTTTTGATTCTCTGGGGCCAA
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_14_213_0:0:0_0:0:0_13/1
TGGGATGGATCAACGCTGGCAATGGTAACACAAAATATTCACAGAAGTTCCAGGGCAGAGTCACCATTACCAGGGACACATCCGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCTGTGTATTACTGTGCGAGAGTGGGCAGCAGCTGGTCTGATGCTTTTGATTATCTGGGGCCAAGGGAC
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_27_226_0:0:0_3:0:0_14/1
GAGGGTGACCATTGTCCCTTGGCCCCAGATAATCAAAAGCATCAGACCAGCTGCTGCCCACTCTCGCACAGTAATACACAGCCGTGTCTTCAGATCTCAGGCTGGTCAGCTCCATGTAGGCTGTGCTCGCGGATGTGTCCCTGGTAATGGTGACTCTGCCCTGGAACTTCTGTGAATATATTGTGTTACCATTGCCAGCG
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_9_208_0:0:0_2:0:0_15/1
TTGGCCCCAGATAATCAAAAGCATCAGACCAGCTGCTGCCCACTCTCGCACAGTAATACACAGCCGTGTCTTCAGATCTCAGGCTGCTCAGCTCCATGTAGGCTGTGCTCGCGGATGTGTCCCTGGTAATGGTGCCTCTGCCCTGGAACTTCTGTGAATATTTTGTGTTACCATTGCCAGCGTTGATGCATCCCATCCAC
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_15_214_1:0:0_0:0:0_16/1
GGGATGGATCAACGCTGGCAATGGTAACACAAAATATTCACAGAAGTTCCAGGGCAGAGTCACCATTACCAGGGACACATCCGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCTGTGTATTACTGTGCGAGAGTGGGCAGCAGCTGGTCTGATGCTTTTGCTTATCTGGGGCCAAGGGACA
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_26_225_0:0:0_3:0:0_17/1
ACGGTGACCATTGTCCCTTGGCCCCAGATAATCAAAAGCATCAGACCAGCTGCTGCCCACTCTCGCACAGTAATACACAGCCGTGTCTTCAGATCTGAGGCTGCACAGCTCCATGTAGGCTGTGCTCGCGGATGTGTCCCTGGTAATGGTTACTCTGCCCTGGAACTTCTGTGAATATTTTGTGTTACCATTGCCAGCGT
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_34_233_0:0:0_1:0:0_18/1
CTGAGGAGACGGTGACCATTGTCCCTTGGCCCCAGATAATCAAAAGCATCAGACCAGCTGCTGCCCACTCTCGCACAGTAATACACAGCCGTGTCTTCATATCTCAGGCTGCTCAGCTCCATGTAGGCTGTGCTCGCGGATGTGTCCCTGGTAATGGTGACTCTGCCCTGGAACTTCTGTGAATATTTTGTGTTACCATT
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_28_227_0:0:0_0:0:0_19/1
AGACGGTGACCATTGTCCCTTGGCCCCAGATAATCAAAAGCATCAGACCAGCTGCTGCCCACTCTCGCACAGTAATACACAGCCGTGTCTTCAGATCTCAGGCTGCTCAGCTCCATGTAGGCTGTGCTCGCGGATGTGTCCCTGGTAATGGTGACTCTGCCCTGGAACTTCTGTGAATATTTTGTGTTACCATTGCCAGC
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_24_223_4:0:0_0:0:0_1a/1
CAACGCTGGCAAAGGTAACACAAACTATTCACAGAAGTTCCAGGGCAGAGTCACCATTACCAGGGACCCATCCGCGAGCACAGCCTAGATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCTGTGTATTACTGTGCGAGAGTGGGCAGCAGCTGGTCTGATGCTTTTGATTATCTGGGGCCAAGGGACAATGGTCACC
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_13_212_0:0:0_4:0:0_1b/1
TCCCTTGGCCCCAGATAATCAAAAGCATCAGACCAGCTGCTGCCCACTCTCGCACAGTAAAACACAGCCGTGTCTTCAGATCTCAGGCTGCTCAGCTCCATGTAGGCAGTGCTCGCGGATGTGTCCCTGGTAATGGTGACTCTGCCCTGGAACTTCTGTGAATATTTTGTGTTACCATTGCCAGCGTTGATCCCTCGCAT
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_4_203_0:0:0_3:0:0_1c/1
CCCAGATAATCCAAAGCATCAGACCAGCTGCTGCCCACTCTCGCACAGTAATACACAGCCGTGTCTTCAGATCTCAGGCTGCTCAGCTCCATGTAGGCTGTGCTCGCGGATGTGTCCCTGGTAATGGTGACTCTGCCCTGGAACTTCTGTGAATATTTTGATTTACCATTGCCAGCGTTGATCCATCCCATCCACTCAAG
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_33_232_2:0:0_0:0:0_1d/1
CAATGGTAACACAAAATATTCACAGAAGTTCCAGGGCAGAGTCACCATTACCAGGGACACATCCGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGACGACACGGCTGTGTATTACTGTGCGAGAGTGGGCAGCAGGTGGTCTGATGCTTTTGATTATCTGGGGCCAAGGGACAATGGTCACCGTCTCCTCA
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_19_218_0:0:0_1:0:0_1e/1
CCATTGTCCCTTGGCCCCAGATAATCAAAAGCATCAGACCAGCTGCTGCCCACTCTCGCACAGTAATACACAGCCGAGTCTTCAGATCTCAGGCTGCTCAGCTCCATGTAGGCTGTGCTCGCGGATGTGTCCCTGGTAATGGTGACTCTGCCCTGGAACTTCTGTGAATATTTTGTGTTACCATTGCCAGCGTTGATCCA
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_7_206_0:0:0_1:0:0_1f/1
GGCCCCAGATAATCAAAAGCATCAGACCAGCTGCTGCCCACTCTCGCACAGTAATACACAGCCGTGTCTTCAGATCTCAGGCTGCTCAGCTCCATGTAGGCAGTGCTCGCGGATGTGTCCCTGGTAATGGTGACTCTGCCCTGGAACTTCTGTGAATATTTTGTGTTACCATTGCCAGCGTTGATCCATCCCATCCACTC
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_16_215_0:0:0_1:0:0_20/1
TTGTCCCTTGGCCCCAGATAATCAAAAGCATCAGACCAGCTGCTGCCCACTCTCGCACAGTAATACACAGCCGTGTCTTCAGATCTCAGGCTGCTCAGCTCCATGTAGGCTGTGCTCGCGGATGTGTCCCTGGTAATGGTGACTCTGCCCTGGAACTTCTGTGAATATTTTGTGTTACCATTGCCATCGTTGATCCATCC
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_15_214_2:0:0_1:0:0_21/1
GGGATGGATCAACGCTGGCAATGGTAACACAAAATATTCACATAAGTTCCAGGGCAGATTCACCATTACCAGGGACACATCCGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCTGTGTATTACTGTGCGAGAGTGGGCAGCAGCTGGTCTGATGCTTTTGATTATCTGGGGCCAAGGGACA
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_13_212_2:0:0_0:0:0_22/1
ATGGGATGGATCAACGCTGGCAATGGTAACACAAAATATTCACAGAAGTTCCAGGGCAGAGTCACCATTACCAGGGACACATCCGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATGTGAAGACACGGCTGTGTATTACTGTGCGAGAGTGGGCAGCAGCTGGTCTGCTGCTTTTGATTATCTGGGGCCAAGGGA
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_17_216_0:0:0_3:0:0_23/1
ATTGTCCCTTGGCCCCAGATAATCAAAAGCATCAGACCAGCTGCTGCCCACTCTCGCACAGTAATACACAGCCTTGTCTACAGATCACAGGCTGCTCAGCTCCATGTAGGCTGTGCTCGCGGATGTGTCCCTGGTAATGGTGACTCTGCCCTGGAACTTCTGTGAATATTTTGTGTTACCATTGCCAGCGTTGATCCATC
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_10_209_0:0:0_0:0:0_24/1
TGGATGGGATGGATCAACGCTGGCAATGGTAACACAAAATATTCACAGAAGTTCCAGGGCAGAGTCACCATTACCAGGGACACATCCGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCTGTGTATTACTGTGCGAGAGTGGGCAGCAGCTGGTCTGATGCTTTTGATTATCTGGGGCCAAG
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_33_232_0:0:0_1:0:0_25/1
TGAGGAGACGGTGACCATTGTCCCTTGGCCCCAGATAATCAAAAGCATCAGACCAGCTGCTGCCCACTCTCGCACAGTAATACACAGCCGTGTCATCAGATCTCAGGCTGCTCAGCTCCATGTAGGCTGTGCTCGCGGATGTGTCCCTGGTAATGGTGACTCTGCCCTGGAACTTCTGTGAATATTTTGTGTTACCATTG
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_20_219_4:0:0_0:0:0_26/1
GGATCAACGCTGGCAATGGTAACCCAAAATATTCACAGAAGTACCAGGGCAGATTCACCATTACCAGGGACACATCCGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGCTCTGAAGACACGGCTGTGTATTACTGTGCGAGAGTGGGCAGCAGCTGGTCTGATGCTTTTGATTATCTGGGGCCAAGGGACAATGGT
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_11_210_0:0:0_1:0:0_27/1
CCTTGGCCCCAGATAATCAAAAGCATCAGACCAGCTGCTGCCCACTCTCGCACAGTAATACACAGCCGTGTCTTCAGATCTCAGGCTGCTCATCTCCATGTAGGCTGTGCTCGCGGATGTGTCCCTGGTAATGGTGACTCTGCCCTGGAACTTCTGTGAATATTTTGTGTTACCATTGCCAGCGTTGATCCATCCCATCC
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_4_203_0:0:0_4:0:0_28/1
CCCAGATAATCAAAAGCATCAGCCGAGCTGCTGCCCACTCTCGCACAGTACTACACAGCCGTGTCTTCAGATCTCAGGCTGCTCAGCTCCATGTAGGCTGTGCTCGCGGATGTGTCCCTGGTAATGGTGACTCTGCCCTGGAACTTCTGTGAATATTTTGTGTTACCATTGCCAGCGTTGAACCATCCCATCCACTCAAG
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_26_225_6:0:0_0:0:0_29/1
ACGCTGGCAATGGTAACACAAAATATTCACAGAAGTTCCAGGGGAGAGTCACCATTACCAGGGACACATCCGCGAGCACAGCCTACATGGAGCTTAGCAGCCTGAGATCTGAAGACACGGCTGTGTATTACAGTGCGAGAGTGTGGAGCAGCTGGTCTGATGCTTTTGATTATCTGGGGCCAAGGGACAATGGTCCCCGT
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_11_210_1:0:0_0:0:0_2a/1
GGATGGGATGGATCAACGCTGGCAATGGTAACACAAAATATTCACAGAAGTTCCAGGGCAGAGTCACCATAACCAGGGACACATCCGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCTGTGTATTACTGTGCGAGAGTGGGCAGCAGCTGGTCTGATGCTTTTGATTATCTGGGGCCAAGG
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_20_219_3:0:0_0:0:0_2b/1
GGATGAAGGCTGGCAATGGTAACACAAAATATTCACAGAAGTTCCAGGGCAGAGTCACCATTACCAGGGACACATCCGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACAGGGCTGTGTATTACTGTGCGAGAGTGGGCAGCAGCTGGTCTGATGCTTTTGATTATCTGGGGCCAAGGGACAATGGT
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_17_216_0:0:0_4:0:0_2c/1
ATTGTCCCTTGGCCCCAGATAATCAAAAGCATCAGACCAGCTGCTGCGCACTCTCGCACAGTAATACAGAGCCGTGTCTTCAGATCTCAGGCTGCTCAGCTCCATGTAGGCTGTGCTCGCGTATGTGTCCCTGGTAATGGTGACTCTGCCCTGGAACTTCTGTGAATATTTAGTGTTACCATTGCCAGCGTTGATCCATC
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_7_206_0:0:0_1:0:0_2d/1
GGCCCCAGATAATCAAAAGCATCAGACCAGCTGCTGCCCACTCTCGCACAGTAATACACAGCCGTGTCTTCAGATCTCAGGCTGCTCAGCTCCATGTAGGCTGTGCTCGCGGATGTGTCCCTGGTAATGGTGACTCTGCGCTGGAACTTCTGTGAATATTTTGTGTTACCATTGCCAGCGTTGATCCATCCCATCCACTC
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_14_213_0:0:0_0:0:0_2e/1
GTCCCTTGGCCCCAGATAATCAAAAGCATCAGACCAGCTGCTGCCCACTCTCGCACAGTAATACACAGCCGTGTCTTCAGATCTCAGGCTGCTCAGCTCCATGTAGGCTGTGCTCGCGGATGTGTCCCTGGTAATGGTGACTCTGCCCTGGAACTTCTGTGAATATTTTGTGTTACCATTGCCAGCGTTGATCCATCCCA
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_13_212_0:0:0_5:0:0_2f/1
TCCCTAGGCCCCAGATAATCAAAAGCATCAGACCAGCTGCTGCGCACTCTCGCACAGTAATACACAGCCGTGTCTTCAGATCTCAGGCTGCTCAGCTCCATGTAGGCTGTGCTCGCGGATGTGTGCCTGGTAATGGTGACTCTGCCCTGGAACTTCTGTGAATATTTAGTGTTCCCATTGCCAGCGTTGATCCATCCCAT
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
@clone2_15_214_2:0:0_0:0:0_30/1
GGGATGGATCAACGCTGGCAATGGTAACACAAAATATTCACAGAAGTTCCAGGGCAGAGTGACCATTACCAGGGACACATCCGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCTGTGTATTACTGTGCGAGATTGGGCAGCAGCTGGTCTGATGCTTTTGATTATCTGGGGCCAAGGGACA
+
55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555
>clone1
ggctggagtgggtttcatacattagtagtaatagtggtgccatatactacgcagactctgtgaagggccgattcaccatctccagaaacaatgccaaggactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgcgagagcgatcccccggtattactatgatactagtggcccaaacgactactggggccagggaaccctggtcaccgtctcctcag
>clone2
aggcttgagtggatgggatggatcaacgctggcaatggtaacacaaaatattcacagaagttccagggcagagtcaccattaccagggacacatccgcgagcacagcctacatggagctgagcagcctgagatctgaagacacggctgtgtattactgtgcgagagtgggcagcagctggtctgatgcttttgattatctggggccaagggacaatggtcaccgtctcctcag
#!/bin/sh
wget http://www.emi.unsw.edu.au/~ihmmune/Stanford_S22.zip
unzip -d $(dirname $0) -o Stanford_S22.zip
rm -f Stanford_S22.zip
>lcl|FLN1FA002RWEZA.1|
ggctggagtgggtttcatacattagtagtaatagtggtgccatatactacgcagactctgtgaagggccgattcaccatc
tccagaaacaatgccaaggactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgc
gagagcgatcccccggtattactatgatactagtggcccaaacgactactggggccagggaaccctggtcaccgtctcct
cag
>lcl|FLN1FA001BLION.1|
aggcttgagtggatgggatggatcaacgctggcaatggtaacacaaaatattcacagaagttccagggcagagtcaccat
taccagggacacatccgcgagcacagcctacatggagctgagcagcctgagatctgaagacacggctgtgtattactgtg
cgagagtgggcagcagctggtctgatgcttttgattatctggggccaagggacaatggtcaccgtctcctcag
>lcl|FLN1FA002SGU3N.1|
gggcctggagtgggtctcaggtattagttggaatagtggtagaataggctatgcggactctgtgaacggccgattcacca
tctccagagacaacgccaagaactccctgtatctgcaaatgaacagtctgagagctgaggacacggccttgtattactgt
gcaaaagataaaattgggtattatgattacgtttgggggagttatcgtttgggtctactggggccagggaaccctggtca
ccgtctcctcag
>Junc#01
TATTACTGTGCCACCTGGGCCTTATTATAAGAAACTCTTT
>Junc#05
TACTACTGTGCTGCGTGGAGACCCACTGGTTGGTTCAAGA
>Rep#01
CTCATACACCCAGGAGGTGGAGCTGGATATTGATACTACGAAATCTAATTGAAAATGATTCTGGGGTCTATTACTGTGCCACCTGGGCCTTATTATAAGAAACTCTTTGGCAGTGGAAC
>Rep#05
ATCCTTACCATCAAGTCCGTAGAGAAAGAAGACATGGCCGTTTACTACTGTGCTGCGTGGAGACCCACTGGTTGGTTCAAGATATTTGCTGAAGGGACTAAGCTCATAGTAACTT
>Junc_rc#05
TCTTGAACCAACCAGTGGGTCTCCACGCAGCACAGTAGTA
>Rep_rc#01
GTTCCACTGCCAAAGAGTTTCTTATAATAAGGCCCAGGTGGCACAGTAATAGACCCCAGAATCATTTTCAATTAGATTTCGTAGTATCAATATCCAGCTCCACCTCCTGGGTGTATGAG
>Rep_rc#05
AAGTTACTATGAGCTTAGTCCCTTCAGCAAATATCTTGAACCAACCAGTGGGTCTCCACGCAGCACAGTAGTAAACGGCCATGTCTTCTTTCTCTACGGACTTGATGGTAAGGAT
\ No newline at end of file
>seq1
aagtccatcagcactgcctacctgcagtggagcagcctgaaggcctcggacaccgccatgtattactgtgcgaCTTCataaccggaaccaGTTAtggttcgactcctggggccaaggaaccctggtcaccgtctcctcag
>seq1_polyT
TTTTTTTTTTaagtccatcagcactgcctacctgcagtggagcagcctgaaggcctcggacaccgccatgtattactgtgcgaCTTCataaccggaaccaGTTAtggttcgactcctggggccaaggaaccctggtcaccgtctcctcagTTTTTTTTTT
>seq1
ACAAC
>seq2
C
G
ACCCCCAA
>seq3
A
>seq4
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
>
A
A
T
N
\ No newline at end of file
@seq1
ACAAC
+
11111
@seq2
CGACCCCCAA
+
1111111111
@seq3
A
+seq3
1
@seq4
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+
@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
@
AATN
+
=5$2
2013-04-18 The Vidjil Team
* First public release
# Vidjil -- V(D)J recombinations analysis <http://bioinfo.lifl.fr/vidjil>
# Copyright (C) 2011, 2012, 2013 by Bonsai bioinformatics at LIFL (UMR CNRS 8022, Université Lille) and Inria Lille
# Contact: mathieu.giraud@lifl.fr, mikael.salson@lifl.fr
V(D)J recombinations in lymphocytes are a key for immunologic diversity
as they have an influence on the production of antibodies and antigen
receptors. They are also useful markers for pathologies: in many
cases, such a clonality marker is used for patient follow-up to
quantify the minimal residual disease in leukemias.
Vidjil process high-througput sequencing data to extract V(D)J
junctions and gather them into clones. This analysis is based on a
seed heuristics and is fast and scalable, as, in the first phase, no
alignment is done with database germline sequences. Starting from a
set of reads, Vidjil detects the junctions in each read. This is based
on an ultra-fast seed-based heuristic, which has be prooven to be
reliable output the most abundant clones, based on their junctions
Vidjil can also clusterize similar clones, or leave this to the user
after a manual review. The method is described in the paper referenced
below.