Commit 932e1eb1 authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

Merge branch 'feature-a/specify-which-shouldvdj-fails' into 'dev'

Specify which shouldvdj fail

See merge request !133
parents 0054ad2c 54693537
Pipeline #11515 passed with stages
in 14 seconds
......@@ -10,8 +10,6 @@ OTHER_SRC=$(wildcard unit-tests/*.cpp)
LIB=../core/vidjil.a ../lib/lib.a
SHOULD=$(wildcard should-get-tests/*.should-get) $(wildcard bugs/*.should-get)
SHOULD_VDJ_EXPECTED_FAILS=--expected-fails 82
SHOULD_VDJ=$(wildcard should-vdj-tests/*.should-vdj.fa)
SHOULD_LOCUS=$(wildcard should-vdj-tests/*.should-locus.fa)
......@@ -68,7 +66,7 @@ shouldvdj_if_python:
shouldlocus: vidjil
shouldlocus_and_vdj: vidjil
@echo "*** Launching .should-vdj-fa tests..."
......@@ -77,19 +75,19 @@ shouldlocus_and_vdj: vidjil
@echo "*** All .should-vdj.fa tests passed"
cat $(SHOULD_VDJ) > should-vdj-tests/should-vdj.merged.fa
$(SHOULD_VDJ_TO_TAP) -r should-vdj-tests/should-vdj.merged.fa
# When the global test suite is passing, individual failed tests (counted in SHOULD_*_EXPECTED_FAILS)
# When the global test suite is passing, individual failed tests (tagged with BUG or BUG-LOCUS in the *.should-vdj.fa files)
# can be marked as 'TODO' to make continuous integration happy
-sed -e "s/^\(not ok [0-9]*\) /\1 # TODO ##/" -i".bak" */*.tap
......@@ -100,7 +98,7 @@ $(SHOULD_VDJ_ARCHIVE)
$(eval tmpdir := $(shell mktemp -d))
mkdir $(tmpdir)/curated-vdj
cp --preserve $(SHOULD_VDJ_ARCHIVE) $(tmpdir)/curated-vdj
sed -r 's/\s*BUG//' -i $(tmpdir)/curated-vdj/*
sed -r 's/\s*BUG[A-Z-]+//' -i $(tmpdir)/curated-vdj/*
for file in $(tmpdir)/curated-vdj/*; do mv $$file `echo $$file | sed 's/should/curated/'`; done
cwd=`pwd` && cd $(tmpdir) && zip $$cwd/$@ curated-vdj/*
rm -rf $(tmpdir)
>TRAV29/DV5*01 3/CACCGAGA/3 TRDD2 1/0/3 TRDD3 0/0/2 TRDJ1 [TRD+] BUG
\ No newline at end of file
# A short Dd1 could also be inserted after the TRDV1
>TRDV1*01 1/C/0 TRDD2*01 2//1 TRDD3*01 1/AGGGT/0 TRDJ1*01 [TRD]
>TRDV1*01 0/0/3 TRDD3 4/11/0 TRDJ1*01 [TRD]
>TRDV1*01 0/0/3 TRDD3 4/11/0 TRDJ1*01 [TRD] BUG
>TRAV29/DV5*01 0/9/0 TRDD3 3/9/2 TRDJ1*01 [TRD]
# IGHD3-9*01 0 .....GTATTACGATATTTTgactggttattataac 31
>IGHD3-9*01 16/CT/23 IGHJ6*02 [IGH+]
>IGHD3-9*01 16/CT/23 IGHJ6*02 [IGH+] BUG
......@@ -2,7 +2,7 @@
#target 0746OC
# Both alleles are possible for IGHV. The *01 is slightly longer (2nt)
# but has 2 mutations instead of 1 for the *03.
>(IGHV5-51*01, IGHV5-51*03) 0/TCCGCCCTA/5 IGHD1-26*01 2/A/2 IGHJ3*02 [IGH]
>(IGHV5-51*01, IGHV5-51*03) 0/TCCGCCCTA/5 IGHD1-26*01 2/A/2 IGHJ3*02 [IGH] BUG
#target 0808TD
......@@ -88,7 +88,7 @@ AAGCCCTATAGTGAGTCGTATTA
# IGHV3-11*01 277 GTGTATTACTGTGCGAGAGA.................................. 331
# IGHD5-24*01 .......................gtaGAGATGGCTACAattac...........
# IGHJ6*03 -31 .......................................CTACTACTACTACAT 23
>IGHV3-11*01 (3/CGAGGGAGC/3, 0/GGGAGC/3) IGHD5-24*01 5/C/7 IGHJ6*03 [IGH]
>IGHV3-11*01 (3/CGAGGGAGC/3, 0/GGGAGC/3) IGHD5-24*01 5/C/7 IGHJ6*03 [IGH] BUG
#target 0889CE
>IGHV1-3*01 3/GCT/2 IGHD2-15*01 22/CCCCCG/16 IGHJ6*02 [IGH]
>IGHV1-3*01 3/GCT/2 IGHD2-15*01 22/CCCCCG/16 IGHJ6*02 [IGH] BUG
......@@ -110,7 +110,7 @@ AAGCCCTATAGTGAGTCGTATTA
#target 0933KC
>IGHV3-7*01 0/TGGGGGTAG/4 IGHD2-2*01 3/CGGAC/3 IGHJ5*02 [IGH]
>IGHV3-7*01 0/TGGGGGTAG/4 IGHD2-2*01 3/CGGAC/3 IGHJ5*02 [IGH] BUG
#target 0956LC
>IGHV6-1*01 5/TCCCGATCGAGG/-6 IGHD3-10*01 -0/AACCT/-4 IGHJ6*02 [IGH]
>IGHV6-1*01 5/TCCCGATCGAGG/-6 IGHD3-10*01 -0/AACCT/-4 IGHJ6*02 [IGH] BUG
......@@ -200,7 +200,7 @@ AGCCCTATAGTGAGTCGTATTA
#target 0969JS
>IGHV5-51*03 0/TTGAGAAGGGTTTTT/5 IGHD6-13*01 2/CCC/6 IGHJ4*02 [IGH]
#target 0990CE
>IGHV3-30*18 4/AAGATTCACCATA/21 IGHD32-21*01 0/GTCGGCCCC/2 IGHD3-22*01 7/CGC/10 IGHJ4*02 [IGH]
>IGHV3-30*18 4/AAGATTCACCATA/21 IGHD32-21*01 0/GTCGGCCCC/2 IGHD3-22*01 7/CGC/10 IGHJ4*02 [IGH] BUG
#target 1202LH
>IGHV5-51*01 1/GATC/4 IGHD7-27*01 0/TCCCAACATAGA/6 IGHJ6*03 [IGH]
>IGHV5-51*01 1/GATC/4 IGHD7-27*01 0/TCCCAACATAGA/6 IGHJ6*03 [IGH] BUG
......@@ -255,7 +255,7 @@ AGCCCTATAGTGAGTCGTATTA
#target 1202LH
>IGHV3-15*01 13/TTTTCCCC/15 IGHD3-22*01 8/GCCC/4 IGHJ4*02 [IGH]
>IGHV3-15*01 13/TTTTCCCC/15 IGHD3-22*01 8/GCCC/4 IGHJ4*02 [IGH] BUG
# target 1266MN
>IGHD4-4*01 5/GCACGAGG/5 IGHJ5*02 [IGH+]
>IGHD4-4*01 5/GCACGAGG/5 IGHJ5*02 [IGH+] BUG
......@@ -20,7 +20,7 @@ accctgggccccctctcctcaggt
# target 1297RC
> IGHV3-74*01 1/0/11 IGHD6-6*01 0/CTCAA/12 IGHJ6*02 [IGH]
> IGHV3-74*01 1/0/11 IGHD6-6*01 0/CTCAA/12 IGHJ6*02 [IGH] BUG
# target 1297RC
>TRDD2*01 1/AATCTGGGATT/0 TRDD3*01 4/AG/24 TRAJ53*01 [TRA+D]
>TRDD2*01 1/AATCTGGGATT/0 TRDD3*01 4/AG/24 TRAJ53*01 [TRA+D] BUG
......@@ -58,7 +58,7 @@ AATTACTTGCCCCTC
# target 1321HW
>IGHV3-30*01 7/GGG/18 IGHD2-21*02 1/GGGGG/2 IGHJ5*02 [IGH]
>IGHV3-30*01 7/GGG/18 IGHD2-21*02 1/GGGGG/2 IGHJ5*02 [IGH] BUG
# target 1321HW
>TRDV2*01 4/TACA/1 TRDD3 [TRD+]
# target 1321HW
>TRDV2*01 4/TAC/0 TRDD3 5/TTTT/2 TRAJ9*01 [TRA+D]
>TRDV2*01 4/TAC/0 TRDD3 5/TTTT/2 TRAJ9*01 [TRA+D] BUG
# target 0933KC
>IGHV3-7*01 0/TGGGGGTAG/4 IGHD2-2*01 3/CGGAC/3 IGHJ5*02 [IGH]
>IGHV3-7*01 0/TGGGGGTAG/4 IGHD2-2*01 3/CGGAC/3 IGHJ5*02 [IGH] BUG
# target 0933KC
#target 0934GO
>IGHV1-NL1*01 0/0/-12 IGHD2-8*02 8/TCCTGTGTGTCCC/8 IGHJ4*02 [IGH]
>IGHV1-NL1*01 0/0/-12 IGHD2-8*02 8/TCCTGTGTGTCCC/8 IGHJ4*02 [IGH] BUG
......@@ -138,7 +138,7 @@ ggccagggaaccctggtcaccgtctcctcagg
#target 0934GO
>IGHV3-30*03 4/AA/7 IGHD3-3*01 13/GCGGGGGCCC/10 IGHD2-8*01 13/ATAAGAGGGTTG/0 IGHJ4*02 [IGH]
>IGHV3-30*03 4/AA/7 IGHD3-3*01 13/GCGGGGGCCC/10 IGHD2-8*01 13/ATAAGAGGGTTG/0 IGHJ4*02 [IGH] BUG
......@@ -146,7 +146,7 @@ tttgactactggggcccgggaaccctggtcaccgtctcctca
#target 0934GO
>IGHV3-30-3*01 0/CGGGGGCG/10 IGHD2-8*01 13/ATAAGAGGGTTG/0 IGHJ4*02 [IGH]
>IGHV3-30-3*01 0/CGGGGGCG/10 IGHD2-8*01 13/ATAAGAGGGTTG/0 IGHJ4*02 [IGH] BUG
#target 0934GO
#target 0934GO
>TRDV2*01 3/CGGAGG/19 TRAJ48*01 [TRA+D]
>TRDV2*01 3/CGGAGG/19 TRAJ48*01 [TRA+D] BUG
#target 1119JC
>IGHV2-26*01 0/GAACCGTCTGGGGA/11 IGHD3-22*01 9/G/8 IGHJ4*02 [IGH]
>IGHV2-26*01 0/GAACCGTCTGGGGA/11 IGHD3-22*01 9/G/8 IGHJ4*02 [IGH] BUG
......@@ -181,7 +181,7 @@ cgtctggggaatggtagtcgtggactactggggccagggaaccctggtcaccgtctcctcaggtaa
#target 1119JC
......@@ -189,7 +189,7 @@ ggggccagggaaccctggtcaccgtctcctcaggtaaa
#target 1119JC
>IGKV1-5*01 7/GCTTT/5 KDE [IGK+]
>IGKV1-5*01 7/GCTTT/5 KDE [IGK+] BUG
......@@ -199,7 +199,7 @@ TATCCACTATT
#target 1119JC
>TRGV2*02 0/CGGG/7 TRGJ1*02 [TRG]
>TRGV2*02 0/CGGG/7 TRGJ1*02 [TRG] BUG
......@@ -221,7 +221,7 @@ TAAGTGTTTCTAGCCA
#target 1119JC
>TRBV6-8*01 0/GAGC/0 TRBD2*01 0/CCT/12 TRBJ2-5*01 [TRB]
>TRBV6-8*01 0/GAGC/0 TRBD2*01 0/CCT/12 TRBJ2-5*01 [TRB] BUG
# 0444-lil-TRA+D
>TRDV1*01 5//3 TRDD2*01 1//7 TRAJ29*01 [TRA+D]
>TRDV1*01 5//3 TRDD2*01 1//7 TRAJ29*01 [TRA+D] BUG
......@@ -9,13 +9,13 @@ gtattatgattacgtttgggggagttatgcttatacc
# Same sequence, but with only the 20bp start of J
>IGHV1-18*01 0//0 IGHD3-16*01 0//0 IGHJ4*01 [IGH]
>IGHV1-18*01 0//0 IGHD3-16*01 0//0 IGHJ4*01 [IGH] BUG
# Same sequence, but with only the 15bp start of J
>IGHV1-18*01 0//0 IGHD3-16*01 0//0 IGHJ4*01 [IGH]
>IGHV1-18*01 0//0 IGHD3-16*01 0//0 IGHJ4*01 [IGH] BUG-LOCUS
\ No newline at end of file
# attactgtgccacctgggATgttaggagaaactctt
# V8 attactgtgccacctgggAT |||||||||
# J1 ttattataagaaactctt
>TRGV8*01 3/GTTAGG/8 TRGJ1*02
......@@ -42,7 +42,6 @@ parser.add_argument('--ignore_cdr3', '-3', action='store_true', help='ignore CDR
parser.add_argument('--after-two', '-2', action='store_true', help='compare only the right part of the pattern after two underscores (locus code)')
parser.add_argument('--revcomp', '-r', action='store_true', help='duplicate the tests on reverse-complemented files')
parser.add_argument('--directory', '-d', default='../..', help='base directory where Vidjil is. This value is used by the default -p and -q values (%(default)s)')
parser.add_argument('--expected-fails', '-e', type=int, default=0, help='number of expected non-TODO failed tests -- do not exit with error for this number')
parser.add_argument('--verbose', '-v', action='store_true')
......@@ -60,14 +59,17 @@ PROG_TAG = '.1'
if args.after_two:
PROG_TAG = '.2'
def special_keywords(after_two):
return SPECIAL_KEYWORDS + ['BUG' + ('-LOCUS' if after_two else '')]
global_failed = 0
global_stats = defaultdict(int)
global_stats_bug = defaultdict(int)
global_stats_failed = defaultdict(int)
global_stats_todo = defaultdict(int)
def should_pattern_to_regex(p):
Converts patterns such as the following ones into a Python regex.
......@@ -86,7 +88,7 @@ def should_pattern_to_regex(p):
if term.startswith('#'):
return []
if term in special_keywords(args.after_two):
return []
# Ambiguous/alternate pattern
......@@ -233,6 +235,9 @@ def should_result_to_tap(should_pattern, result, tap_id):
globals()['global_stats_todo'][locus] += 1
globals()['global_failed'] += 1
if (args.after_two and 'BUG-LOCUS' in should_pattern)\
or (not args.after_two and 'BUG' in should_pattern):
globals()['global_stats_bug'][locus] += 1
tap += 'not '
......@@ -243,7 +248,7 @@ def should_result_to_tap(should_pattern, result, tap_id):
special = False
warn = False
for kw in special_keywords(args.after_two):
if kw in should_pattern:
tap += '# %s ' % kw
special = True
......@@ -329,17 +334,18 @@ if __name__ == '__main__':
print "=== Summary, should-vdj tests ===" + (' (only locus)' if args.after_two else '')
print " tested passed failed (todo)"
print " tested passed bug failed (todo)"
for locus in sorted(global_stats):
print " %-5s %4d %4d %4d %4s" % (locus, global_stats[locus], global_stats[locus] - global_stats_failed[locus], global_stats_failed[locus],
print " %-5s %4d %4d %4d %4d %4s" % (locus, global_stats[locus], global_stats[locus] - global_stats_failed[locus], global_stats_bug[locus], global_stats_failed[locus],
("(%d)" % global_stats_todo[locus] if global_stats_todo[locus] else ''))
print " ===== %4d %4d %4d %4s" % (sum(global_stats.values()), sum(global_stats.values()) - sum(global_stats_failed.values()), sum(global_stats_failed.values()),
print " ===== %4d %4d %4d %4d %4s" % (sum(global_stats.values()), sum(global_stats.values()) - sum(global_stats_failed.values()), sum(global_stats_bug.values()), sum(global_stats_failed.values()),
"(%d)" % sum(global_stats_todo.values()))
if args.revcomp:
args.expected_fails *= 2
if not global_failed == args.expected_fails:
print "! We were expecting %s non-TODO failed tests, but there are %s such failures." % (args.expected_fails, global_failed)
global_bug = sum(global_stats_bug.values())
if global_bug < global_failed:
print "! We were expecting %s failed tests, but there are %s such failures." % (global_bug, global_failed)
if global_bug > global_failed:
print "! There were less failed sequences that expected. Please update the files accordingly!"
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment