Commit 922de36b authored by Mathieu Giraud's avatar Mathieu Giraud

doc/algo.org: Auxiliary output files

parent bb87daa6
......@@ -411,9 +411,25 @@ The main output of Vidjil (with the default =-c clones= command) are two followi
By default, the two output files are named =out/basename.vidjil= in =out/basename.vdj.fa=, where:
- =out= is the directory where all the outputs are stored, including auxiliary output files (can be changed with the =-o= option)
- =out= is the directory where all the outputs are stored (can be changed with the =-o= option).
- =basename= is the basename of the input =.fasta/.fastq= file (can be overriden with the =-b= option)
** Auxiliary output files
The auxiliary files include =out/basename.windows.fa= (list of windows, with number of occurrences, as below)
and =out/seq/clone.fa-*= (detailed analysis by clone).
#+BEGIN_EXAMPLE
>8--window--1
ATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGG
>5--window--2
ATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTACTACATGGAC
(...)
#+END_EXAMPLE
Windows of size 50 (modifiable by =-w=) have been extracted.
The first window has 8 occurrences, the second window has 5 occurrences.
** Unsegmentation causes
......
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment