Une MAJ de sécurité est nécessaire sur notre version actuelle. Elle sera effectuée lundi 02/08 entre 12h30 et 13h. L'interruption de service devrait durer quelques minutes (probablement moins de 5 minutes).

Commit 9127fc19 authored by Mikaël Salson's avatar Mikaël Salson Committed by Mathieu Giraud
Browse files

stanford-json.should-get: Slightly different representative.

Following modifications in representative computation, and in this case
due to the change in the seed for representative computation, the representative
is one base shorter at the start.
parent 379aecd1
......@@ -11,7 +11,7 @@ $ Most abundant window
1:"id": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC".*"reads": \\[8\\]
$ Affect values are over all the sequence
1: "affectValues": .[^}]*"start": 1, "stop": 128
1: "affectValues": .[^}]*"start": 1, "stop": 127
$ No quality information here
0: "quality"
......@@ -33,21 +33,21 @@ $ Segmentation
# JUNCTION: 53 -> 97
$ Segmentation details - V
1:"5": ."delRight": 6, "name": "IGHV3-23.05", "stop": 55.
1:"5": ."delRight": 6, "name": "IGHV3-23.05", "stop": 54.
$ Segmentation details - D
1:"4": ."delLeft": 9, "delRight": 0, "name": "IGHD6-13.01", "start": 74, "stop": 85.
1:"4": ."delLeft": 9, "delRight": 0, "name": "IGHD6-13.01", "start": 73, "stop": 84.
$ Segmentation details - J
1:"3": ."delLeft": 5, "name": "IGHJ4.02", "start": 86.
1:"3": ."delLeft": 5, "name": "IGHJ4.02", "start": 85.
$ Segmentation details - N1, N2
1:"N1": 18,
1:"N2": 0,
$ Segmentation details - CDR3, JUNCTION
1:"cdr3": ."aa": "TREEQYSSWYFDF", "start": 56, "stop": 94.
1:"junction": ."aa": "CTREEQYSSWYFDFW", .* "start": 53, "stop": 97.
1:"cdr3": ."aa": "TREEQYSSWYFDF", "start": 55, "stop": 93.
1:"junction": ."aa": "CTREEQYSSWYFDFW", .* "start": 52, "stop": 96.
$ Second sequence has a DNA sequence provided
1:"id": "TGTGCGAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTAC".*"sequence": "[ACGT]+",
......
......@@ -22,7 +22,7 @@ $ First clone -- find the good number of reads
2:clone-001--.*--0000008
$ First clone -- find the good representative
1:clone-001--.*--lcl.FLN1FA001CPAUQ.1.-.105,232.-.2
1:clone-001--.*--lcl.FLN1FA001CPAUQ.1.-.106,232.-.2
$ First clone -- find the good coverage
1:clone-001--.* 128 bp .55. of 232.0 bp.
1:clone-001--.* 127 bp .54. of 232.0 bp.
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment