Commit 91053f4c authored by Mathieu Giraud's avatar Mathieu Giraud

tests: ignore $EXTRA for tests on other programs than vidjil-algo

parent 899486f2
!LAUNCH: export REQUEST_METHOD=POST ; export CONTENT_TYPE=test ; $LAUNCHER $VIDJIL_DIR/tools/align.cgi < $VIDJIL_DATA/msa.fa
!LAUNCH: export REQUEST_METHOD=POST ; export CONTENT_TYPE=test ; echo ignore $EXTRA ; $LAUNCHER $VIDJIL_DIR/tools/align.cgi < $VIDJIL_DATA/msa.fa
$ no spurious info
0: .* bp in .* sequences
......
!LAUNCH: export REQUEST_METHOD=POST ; export CONTENT_TYPE=test ; $LAUNCHER $VIDJIL_DIR/tools/align.cgi < $VIDJIL_DATA/msa2.fa
!LAUNCH: export REQUEST_METHOD=POST ; export CONTENT_TYPE=test ; echo ignore $EXTRA ; $LAUNCHER $VIDJIL_DIR/tools/align.cgi < $VIDJIL_DATA/msa2.fa
$ no spurious info
0: .* bp in .* sequences
......
!LAUNCH: export REQUEST_METHOD=POST ; export CONTENT_TYPE=test ; $LAUNCHER $VIDJIL_DIR/tools/align.cgi < $VIDJIL_DATA/msa3.fa
!LAUNCH: export REQUEST_METHOD=POST ; export CONTENT_TYPE=test ; echo ignore $EXTRA ; $LAUNCHER $VIDJIL_DIR/tools/align.cgi < $VIDJIL_DATA/msa3.fa
$ no spurious info
0: .* bp in .* sequences
......
!LAUNCH: ../../tools/align -m 1 -i 2 -j 1 -x $VIDJIL_DATA/trd-dd2-dd3.fa $VIDJIL_DIR/germline/homo-sapiens/TRDD.fa
!LAUNCH: echo ignore $EXTRA ; $LAUNCHER ../../tools/align -m 1 -i 2 -j 1 -x $VIDJIL_DATA/trd-dd2-dd3.fa $VIDJIL_DIR/germline/homo-sapiens/TRDD.fa
$ Load correct sequences
1:TRDD2.01_0//0_TRDJ1.01 .*trd-dd2-dd3.fa
......
!LAUNCH: ../../tools/align -m 6 -i 0 -j 1 $VIDJIL_DATA/msa.fa
!LAUNCH: echo ignore $EXTRA ; $LAUNCHER ../../tools/align -m 6 -i 0 -j 1 $VIDJIL_DATA/msa.fa
$ Default cost and parameters
1: (4, -6/-10/-10, -9999-9999/-9999-9999, -1, -10)
......
!LAUNCH: ../../tools/similarity $VIDJIL_DATA/msa.fa
!LAUNCH: echo ignore $EXTRA ; $LAUNCHER ../../tools/similarity $VIDJIL_DATA/msa.fa
$ Read 3 sequences
1: 54 bp in .* 3 sequences
......
!LAUNCH: echo "CCGAGGACACAGCCGTGTATTTTTTCCCCTAGTGGTTGCCCCTTTGACTACTGGGGCCAGGGAACC" | ../../tools/vdj_assign - $VIDJIL_DIR/germline/homo-sapiens/IGH V J "IGHV3-15*01" "IGHJ4*02"
!LAUNCH: echo ignore $EXTRA ; $LAUNCHER echo "CCGAGGACACAGCCGTGTATTTTTTCCCCTAGTGGTTGCCCCTTTGACTACTGGGGCCAGGGAACC" | ../../tools/vdj_assign - $VIDJIL_DIR/germline/homo-sapiens/IGH V J "IGHV3-15*01" "IGHJ4*02"
$ Compute correct coordinates
1: read .* 1 .* 60
......
!LAUNCH: ../../tools/vdj_assign CCGAGGACACAGCCGTGTATTTTTTCCCCTAGTGGTTGCCCCTTTGACTACTGGGGCCAGGGAACC $VIDJIL_DIR/germline/homo-sapiens/IGH V J IGHV IGHJ
!LAUNCH: echo ignore $EXTRA ; $LAUNCHER ../../tools/vdj_assign CCGAGGACACAGCCGTGTATTTTTTCCCCTAGTGGTTGCCCCTTTGACTACTGGGGCCAGGGAACC $VIDJIL_DIR/germline/homo-sapiens/IGH V J IGHV IGHJ
$ Compute correct coordinates
1: read .* 1 .* 60
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment