Commit 909f38c0 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: CDR3/JUNCTION, difficult or non-working sequences

parent f421f6d2
>TRBV6-1*01 3/5/2 TRBJ2-7*01 [TRB] >TRBV6-1*01 3/5/2 TRBJ2-7*01 [TRB]
# {CASKVSP!YEQYF} # TODO: insert at the end of V
# AGC commun aux deux segments # AGC commun aux deux segments
>TRBV7-2*02 0/0/3 TRBJ2-3*01 [TRB] >TRBV7-2*02 0/0/3 TRBJ2-3*01 [TRB]
# {CASSFSTDTQYF} # TODO: insert at the end of V
>TRBV11-2*01 1/4/0 TRBJ2-7*01 [TRB] {CASSLGPSYEQYF} >TRBV11-2*01 1/4/0 TRBJ2-7*01 [TRB] {CASSLGPSYEQYF}
>TRAV29/DV5*01 0/9/0 TRDD3 3/9/2 TRDJ1*01 [TRD] >TRAV29/DV5*01 0/9/0 TRDD3 3/9/2 TRDJ1*01 [TRD]
>TRDV1 5/14/0 TRDJ1*01 [TRD] >TRDV1 5/14/0 TRDJ1*01 [TRD] {CALGTLSRV!TDKLIF}
# IMGT/JunctionAnalysis: {CALGTLS!VYTDKLIF}
# or IGHV3-74*01 (-9) # or IGHV3-74*01 (-9)
# There could be {CQQYNRLWTF}, but the Cys104 is one nucleotide outside of V3-74*02 7/
>IGHV3-74*02 7/CCGCGGT/6 IGHD3-9*01 4/CTTCGAACA/7 IGHJ4*02 [IGH] >IGHV3-74*02 7/CCGCGGT/6 IGHD3-9*01 4/CTTCGAACA/7 IGHJ4*02 [IGH]
...@@ -5,7 +5,8 @@ ...@@ -5,7 +5,8 @@
# With only one D, this is: # With only one D, this is:
# IGHV5-10-1*01 2/CTTC/3 IGHD1-14*01 1/GTTA/5 IGHJ5*01 [IGH] # IGHV5-10-1*01 2/CTTC/3 IGHD1-14*01 1/GTTA/5 IGHJ5*01 [IGH]
>IGHV5-10-1*01 2/CTTC/3 IGHD1-14*01 1//23 IGHD3-16*01 8//7 IGHJ5*01 [IGH] >IGHV5-10-1*01 2/CTTC/3 IGHD1-14*01 1//23 IGHD3-16*01 8//7 IGHJ5*01 [IGH] {CATS*PEPVM!FDSW}
# IMGT/JunctionAnalysis: {CATS*PEPV!WFDSW}
aagtccatcagcactgcctacctgcagtggagcagcctgaaggcctcggacaccgccatgtattactgtgcga aagtccatcagcactgcctacctgcagtggagcagcctgaaggcctcggacaccgccatgtattactgtgcga
ataaccggaacca ataaccggaacca
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment