Merge branch 'feature-a/ensure-tab-after-name' into 'dev'

Ensure tab after name

See merge request !430

algo/core/segment.cpp

@@ -361,7 +361,7 @@ string Segmenter::getInfoLine() const
 {
   string s = "" ;
 
-  s += (segmented ? "" : "! ") + info ;
+  s += (segmented ? "" : "\t ! ") + info ;
   s += " " + info_extra ;
   s += " " + segmented_germline->code ;
   s += " " + string(segmented_mesg[because]) ;

algo/tests/data/segment-or-not.fa

+>lcl|FLN1FA002RWEZA.1| 
+ggctggagtgggtttcatacattagtagtaatagtggtgccatatactacgcagactctgtgaagggccgattcaccatc
+tccagaaacaatgccaaggactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgc
+gagagcgatcccccggtattactatgatactagtggcccaaacgactactggggccagggaaccctggtcaccgtctcct
+cag
+>unsegmented
+CGAATGCCTACATAGGGCTGGACGGCGTGCGTATTCCGTTACTACGACGATTCAAGGTAGTACAGCAAGACCACTGACCACTCCCGTGAGATATTTACCGAACGCCATTACGTATTGACACCGCAGTAATGACCTGGGTGGGGCATAGTCAAATTTCTGATGCTGGATAGTTTAATCCGCAGAGATTTTGTACTTGGCGATTGCTACACGATGTGTAGTAAATGATGAATATTCATAATCACCTTTCTGTGCCGATGGCATAGGGGGACCAATACCTCTGTTCGATGAACTAAGCTGGGA
+>unexpected-IGHV-TRGJ
+ATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAG
+CGATCCCCCGGTATTACTATGATACTAGTGGCCCAAAC
+atagtagtgattggatcaagacgtttgcaaaagggactaggctcatagtaacttcgcctg
\ No newline at end of file

algo/tests/repseq_vdj.py

@@ -267,9 +267,15 @@ def should_results_from_vidjil_output(f_log):
         if l[0] == '>':
             l = l.strip()
             pos = l.find(' + ') if ' + ' in l else l.find(' - ')
+            if pos == -1:
+                pos = l.find(' ! ')
+            if pos == -1:
+                raise ValueError("No [+-!] in the line: {}".format(l))
             should = l[1:pos].replace('_', ' ')
 
             pos = l.find('\t')
+            if pos == -1:
+                raise ValueError("I expected a tabulation to separate the sequence name from the remainder")
             result = l[pos+1:] + ' '
 
             yield (should, result)

algo/tests/should-get-tests/tabs-in-output.should-get

+!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -2 -c designations -g $VIDJIL_DIR/germline  $VIDJIL_DATA/segment-or-not.fa
+
+$ Check that output has one tab for each sequence
+3:^>.*\t
\ No newline at end of file