Commit 8cfdc528 authored by Mathieu Giraud's avatar Mathieu Giraud

Merge branch 'feature-a/ensure-tab-after-name' into 'dev'

Ensure tab after name

See merge request !430
parents 4e5cc9f5 977ed0a8
Pipeline #67343 passed with stages
in 42 minutes and 56 seconds
......@@ -361,7 +361,7 @@ string Segmenter::getInfoLine() const
{
string s = "" ;
s += (segmented ? "" : "! ") + info ;
s += (segmented ? "" : "\t ! ") + info ;
s += " " + info_extra ;
s += " " + segmented_germline->code ;
s += " " + string(segmented_mesg[because]) ;
......
>lcl|FLN1FA002RWEZA.1|
ggctggagtgggtttcatacattagtagtaatagtggtgccatatactacgcagactctgtgaagggccgattcaccatc
tccagaaacaatgccaaggactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgc
gagagcgatcccccggtattactatgatactagtggcccaaacgactactggggccagggaaccctggtcaccgtctcct
cag
>unsegmented
CGAATGCCTACATAGGGCTGGACGGCGTGCGTATTCCGTTACTACGACGATTCAAGGTAGTACAGCAAGACCACTGACCACTCCCGTGAGATATTTACCGAACGCCATTACGTATTGACACCGCAGTAATGACCTGGGTGGGGCATAGTCAAATTTCTGATGCTGGATAGTTTAATCCGCAGAGATTTTGTACTTGGCGATTGCTACACGATGTGTAGTAAATGATGAATATTCATAATCACCTTTCTGTGCCGATGGCATAGGGGGACCAATACCTCTGTTCGATGAACTAAGCTGGGA
>unexpected-IGHV-TRGJ
ATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAG
CGATCCCCCGGTATTACTATGATACTAGTGGCCCAAAC
atagtagtgattggatcaagacgtttgcaaaagggactaggctcatagtaacttcgcctg
\ No newline at end of file
......@@ -267,9 +267,15 @@ def should_results_from_vidjil_output(f_log):
if l[0] == '>':
l = l.strip()
pos = l.find(' + ') if ' + ' in l else l.find(' - ')
if pos == -1:
pos = l.find(' ! ')
if pos == -1:
raise ValueError("No [+-!] in the line: {}".format(l))
should = l[1:pos].replace('_', ' ')
pos = l.find('\t')
if pos == -1:
raise ValueError("I expected a tabulation to separate the sequence name from the remainder")
result = l[pos+1:] + ' '
yield (should, result)
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -2 -c designations -g $VIDJIL_DIR/germline $VIDJIL_DATA/segment-or-not.fa
$ Check that output has one tab for each sequence
3:^>.*\t
\ No newline at end of file
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment