Commit 8cbe8385 authored by Thonier Florian's avatar Thonier Florian Committed by Mathieu Giraud
Browse files

doc/format-analysis.org : add info on delLeft & delRight into documentation

link to #2507.
parent beacde81
......@@ -72,8 +72,8 @@ or =clusters=, to further cluster some clones, see below).
"top": 1,
"seg":
{
"5": {"name": "TRGV5*01", "start": 1, "stop": 86},
"3": {"name": "TRGJ1*02", "start": 89, "stop": 118},
"5": {"name": "TRGV5*01", "start": 1, "stop": 86, "delRight":5},
"3": {"name": "TRGJ1*02", "start": 89, "stop": 118, "delLeft":0},
"cdr3": { "start": 77, "stop": 104, "seq": "gccacctgggccttattataagaaactc" }
}
......@@ -119,9 +119,9 @@ do a correct gathering.
"top": 1,
"seg":
{
"5": {"name": "TRGV5*01", "start": 1, "stop": 86},
"3": {"name": "TRGJ1*02", "start": 89, "stop": 118}
}
"5": {"name": "TRGV5*01", "start": 1, "stop": 86, "delRight": 5},
"3": {"name": "TRGJ1*02", "start": 89, "stop": 118, "delLeft": 0}
}
},
{
"id": "clone2",
......@@ -310,13 +310,14 @@ In the =.analysis= file, this section is intended to describe some specific clon
// names of V/D/J genes should match the ones in files referenced in germline/germline.data
// Positions on the sequence start at 1.
{
"5": {"name": "IGHV5*01", "start": 1, "stop": 120}, // V (or 5') segment
"4": {"name": "IGHD1*01", "start": 124, "stop": 135, "info": "unsure designation"}, // D (or middle) segment
"5": {"name": "IGHV5*01", "start": 1, "stop": 120, "delRight": 5}, // V (or 5') segment
"4": {"name": "IGHD1*01", "start": 124, "stop": 135, "info": "unsure designation", "delRight": 5, "delLeft": 0}, // D (or middle) segment
// Recombination with several D may use "4a", "4b"...
"3": {"name": "IGHJ3*02", "start": 136, "stop": 171}, // J (or 3') segment
"3": {"name": "IGHJ3*02", "start": 136, "stop": 171, "delLeft": 5}, // J (or 3') segment
// any feature to be highlighted in the sequence, with optional fields related to this feature:
// - "start"/"stop" : positions on the clone sequence (starting at 1)
// - "delLeft/delRight" : a numerical value . It is the numbers of nucleotides deleted during the rearangment. DelRight are compatible with V/5 and D/4 segments, delLeft is compatible with D/4 and J/3 segments.
// - "seq" : a sequence
// - "val" : a numerical value
// - "info" : a textual vlaue
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment