Commit 8b7d13b8 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: more tests

parent 7829f8bd
......@@ -13,3 +13,7 @@ $ Clones #01 and #02 are clustered (not together): their windows appear two time
$ Clones #03 is not clustered: its windows appear only once .vidjil ('id')
1:"TGTGAGAGAGCGATCCCCCGGTATTACTAGGATACTAGTGGCCCAAACGA"
$ Clones #01, #02 and #03 have the start of their sequence in .vidjil, on the good strand
1: "sequence": "ACGCTGGCAATGGTAACACAAAATATTCACAGAAG
1: "sequence": "TAGTGGTGCCATATACTACGCAGACTCTGTGAAGG
1: "sequence": "CATTAGTAGTAATAGTGGTGCCATATACTACGCAG
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment