Commit 8aa67229 authored by Mikaël Salson's avatar Mikaël Salson Committed by Mathieu Giraud

segment.h: The minimal window length was actually quite small.

It was hard to make some tests (eg. unsegmentation-causes.should-get) have a
too short window. Modifying a constant just so that the test passes is bad
practice, but this is not the case here (at least I believe so).  Having
difficulties to have a too short w also meant that in practice we would almost
never see a “too short w” again. This could be nice. But we know that the
position of the window is not accurate (it is not designed to be). Therefore
20nt, if they are perfectly centered may be ok. But we know that it may not be
well centered (and we even allow some shifts). Therefore 30nt seems to be a
safer limit.

See #2913
parent 37cec359
......@@ -39,10 +39,12 @@
#define DEFAULT_WINDOW_SHIFT 5 /* Number of nucleotide to try shifting or
reducing the window when it doesn't fit at
its place */
#define MINIMAL_WINDOW_LENGTH 20 /* As we now dynamically adapt the window
#define MINIMAL_WINDOW_LENGTH 30 /* As we now dynamically adapt the window
length we need to specify a minimum
otherwise we could go as low as
2*DEFAULT_WINDOW_SHIFT */
2*DEFAULT_WINDOW_SHIFT. Of course this can
be overriden by the command line by
providing a shorter -w*/
using namespace std;
......
......@@ -36,5 +36,5 @@ ctgcaaaatctaattaaaaatgattctgggttctattactgtgccacctgggacagg
agtggaacaacactggttgtcacag
>too_short_w TRGV1*01 TRGJ1*01
actgtgccacctgggacagg
gaattattataagaaactct
gccacctgggacagg
gaattattataagaa
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment