automaton.hpp: Copy information when defining new defining new final states

When finalising the automaton we can define new final states that
actually are a “copy” of another final state. In such a case we
also need to copy the Info that are in that former final state.

Added a test to check that.
The test uses a IGKJ sequence: thus all the kmers should be +k
or (potentially undetermined).

Fix #4225

algo/core/automaton.hpp

@@ -135,8 +135,10 @@ void PointerACAutomaton<Info>::build_failure_functions() {
     q.pop();
     current_state = couple.first;
     pointer_state<Info> *failed_state = couple.second;
-    if (failed_state->is_final)
+    if (failed_state->is_final) {
       current_state->is_final = true;
+      current_state->informations = failed_state->informations;
+    }
     for (size_t i = 0; i < NB_TRANSITIONS; i++) {
       if (current_state->transitions[i] != NULL) {
         q.push(pair<pointer_state<Info>*, pointer_state<Info>*>(current_state->transitions[i],

algo/tests/bugs/bug4225-j.fa

+>igkj1
+gtggacgttcggccaagggaccaaggtggaaatcaaac
+

algo/tests/bugs/bug4225.should

+!LAUNCH: $VIDJIL_DIR/$EXEC -g $VIDJIL_DIR/germline -r 1 -1 -2 -K bug4225-j.fa
+!OUTPUT_FILE: out/bug4225-j.affects
+
+$ Find only +k and ? affects before the stretch of _ for all loci
+16: seed .*(\+k| \?){28}( _)+$