Commit 8a114b5e authored by marc's avatar marc
Browse files

should-vdj : add sequences from Bristol

parent 3b3d66fa
#target 0746OC
>IGHV5-51*01 0/TCCGCCCTA/5 IGHD1-26*01 2/A/2 IGHJ3*02 [IGH]
TGGAGTCTGGAGCAGAGGTGAAAAAGCCGGGGGAGTCTCTGAAGATCTCCTGT
AAGGGTTCTGGATACAGCTTTACCAGCTACTGGATCGGCTGGGTGCGCCAGATGCCCGGGAAAGGCCTGGAG
TGGATGGGGATCATCTATCCTGGTGACTCTGATACCAGATACAGCCCGTCCTTCCAAGGCCAGGTCACCATC
TCAGCCGACAAGTCCATCAGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTAT
TACTGTGCGAGACATCCGCCCTAAGTGGGAGCTACTA
TGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCCTCAGGTAA
GCCCTATAGTGAGTCGTATTA
#target 0796TH
>IGHV4-59*01 6/CGTGAGGGGGAAGGGCGAGAGGGACCCTAGGTTAAAGGGCTT/3 IGHD6-6*01 3/0/7 IGHJ4*02 [IGH]
AGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGC
TCCATCAGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATC
TATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAG
AACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACTGTGC
CGTGAGGGGGAAGGGCGAGAGGGACCCTAGGTTAAAGGGCTTTATAGCAGCTCGT
GACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTA
AGCCCTATAGTGAGTCGTATTA
#target 0796TH
>IGHV2-26*01 5/TCT/3 IGHD6-13*01 0/GAAATCGGGTAGCGA/1 IGHJ3*02 [IGH]
GTAAAACGACGGCCAGTTCACCTTGAAGGAGTCTGGTCCTGTGCTGGTGAAACCCACAGAGACCCTCACGCT
GACCTGCACCGTCTCTGGGTTCTC
ACTCAGCAATGCTAGAATGGGTGTGAGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACA
CATTTTTTCGAATGACGAAAAATCCTACAGCACATCTCTGAAGAGCAGGCTCACCATCTCCAAGGACACCTC
CAAAAGCCAGGTGGTCCTTACCATGACCAACATGGACCCTGTGGACACAGCCACATATTACTGTGCACG
TCTTATAGCAGCAGCTGGTACGAAATCGGGTAGCGA
GATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCCTCAGGT
#target 0808TD
>IGHV2-5*01 0/GTAAAGGCGAACTTAC/16 IGHD2-2*01 7/AGATT/10 IGHJ4*02 [IGH]
GTAAAACGACGGCCAGTTCACCTTGAAGGAGTCTGGTCCTACGCTGGTGAAACCCACACAGACCCTCA
CGCTGACCTGCACCTTCTCTGGGTTCTCACTCAGCACTAGTGGAGTGGGTGTGGGCTGGATCCGTCAGCCCC
CAGGAAAGGCCCTGGAGTGGCTTGCACTCATTTATTGGAATGATGATAAGCGCTACAGCCCATCTCTGAAGA
GCAGGCTCACCATCACCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGG
ACACAGCCACATATTACTGTGCACACAGAC
GTAAAGGCGAACTTACACCAGCTGAGATT
CTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAGCCCTATAGTGAGTCGTATTA
#target 0816LR
>IGHV1-69*02 0/CGGCCCCT/5 IGHD6-6*01 2/0/15 IGHJ6*02 [IGH]
CTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTT
CTGGAGGCACCTTCAGCAGCTATACTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGG
GAAGGATCATCCCTATCCTTGGTATAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGG
ACAAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTG
CGAGACGGCCCCTTAGCAGCTCGT
ACCTTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTAAGCCCTATAGTGAGTCGTATTA
#target 0816LR
>IGHV2-10*01 1/GC/9 IGHD3-9*01 1/AGGTGAACGTGTA/7 IGHJ4*02 [IGH]
GTAAAACGACGGCCAGTTCACCTTGAAGGAGTCTGGTCCTGCACTGGTGAAACCCACACAGACCCTC
ATGCTGACCTGCACCTTCTCTGGGTTCTCACTCAGCACTTCTGGAATGGGTGTGGGTTAGATCTGTCAGCCC
TCAGCAAAGGCCCTGGAGTGGCTTGCACACATTTATTAGAATGATAATAAATACTACAGCCCATCTCTGAAG
AGTAGGCTCATTATCTCCAAGGACACCTCCAAGAATGAAGTGGTTCTAACAGTGATCAACATGGACATTGTG
GACACAGCCACACATTACTGTGCAAGGAGA
GC
TATTTTGACTGGTTATTATAA
AGGTGAACGTGTA
TGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAGCCCTATAGTGAGTCGTATTA
#target 874MK
>IGHV1-24*01 3/TGAGGAAGGGGG/7 IGHD6-6*01 1/0/9 IGHJ6*02 [IGH]
GTAAAACGACGGCCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAG
GTTTCCGGATACACCCTCACTGAATTATCCATGCACTGGGTGCGACAGGCTCCTGGAAAAGGGCTTGAGTGG
ATGGGAGGTTTTGATCCTGAAGATGGTGAAACAATCTACGCACAGAAGTTCCAGGGCAGAGTCACCATGACC
GAGGACACATCTACAGACACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTAC
TGTGCAACTGAGGAAGGGGGGCAGCTCGTC
ACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGT
AAGCCCTATAGTGAGTCGTATTA
#target 899BR
>IGHV3-11*01 3/CGAGGGAGC/3 IGHD5-24*01 5/C/7 IGHJ6*03 [IGH]
TGGAGTCTGGGGGAGGCTTGGTCAAGCCTGGAGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCT
TCAGTGAC
TACTACATGAGCTGGATCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTTCATACATTAGTAGTAGTGGT
AGTACCATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGGGACAACGCCAAGAACTCACTG
TATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCGAG
CGAGGGAGCGAGATGGCTACAC
CTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAGGT
#target 0889CE
>IGHV1-3*01 3/GCT/2 IGHD2-15*01 22/CCCCCG/16 IGHJ6*02 [IGH]
TAAAACGACGGCCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAG
GCTTCTGGATACACCTTCACTAGCTATGCTATGCATTGGGTGCGCCAGGCCCCCGGACAAAGGCTTGAGTGG
ATGGGATGGATCAACGCTGGCAATGGTAACACAAAATATTCACAGAAGTTCCAGGGCAGAGTCACCATTACC
AGGGACACATCCGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCTGTGTATTAC
TGTGCGAGGCTGATATTGCCCCCG
CGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGT
AAGCCCTATAGTGAGTCGTATTA
#target 0933KC
>IGHV3-7*01 0/TGGGGGTAG/4 IGHD2-2*01 3/CGGAC/3 IGHJ5*02 [IGH]
AAAACGACGGCCAGTAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGAGAC
TCTCCTGTGCAGCCTCTGGATTCACCTTTAGTAGCTATTGGATGAGCTGGGTCCGCCAGGCTCCAGGGAAGG
GGCTGGAGTGGGTGGCCAACATAAAGCAAGATGGAAGTGAGAAATACTATGTGGACTCTGTGAAGGGCCGAT
TCACCATCTCCAGAGACAACGCCAAGAACTCACT
GTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGA
TGGGGGTAGTATTGTAGTAGTACCAGCTGCTAT
CGGACACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAGCCCTATAGTGAGTC
GTATTA
#target 0933KC
>IGHV4-4*02 3/TTC/4 IGHD1-26*01 2/CCTCGGATTTTAAGA/11 IGHJ3*02 [IGH]
CGGGGACCCTGTCCCTCACCTGCGCTGTCTCTGGTGGCTCCATCAGCAGTAGTAACTGGTGGAGTTGGGTCC
GCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGGAAATCTATCATAGTGGGAGCACCAACTACAACCCGT
CCCTCAAGAGTCGAGTCACCATATCAGTAGACAAGTCCAAGAACCAGTTCTCCCTGAAGCTGAG
CTCTGTGACCGCCGCGGACACGGCCGTGTATTACTGTGCGAG
TTC
TAGTGGGAGCTACT
CCTCGGATTTTAAGA
ATATCTGGGGCCAAGGGACAATGGTCACCGTCTCCTCAGGTAAGCCCTATAGTGAGTCGTATTA
#target 1024MH
>IGHV4-4*02 3/CGCTTGGG/5 IGHD2-2*01 6/GAGAGGG/15 IGHJ6*02 [IGH]
GACCCTGTCCCTCACCTGCG
CTGTCTCTGGTGGCTCCATCAGCAGTAGTAACTGGTGGAGTTGGGTCCGCCAGCCCCCAGGGAAGGGGCTGG
AGTGGATTGGGGAAATCTATCATAGTGGGAGCACCAACTACAACCCGTCCCTCAAGAGTCGAGTCACCATAT
CAGTAGACAAGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCGGACACGGCCGTGTATT
ACTGTGCGAG
CGCTTGGG
ATTGTAGTAGTACCAGCTGC
GAGAGGG
ACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTAAGCCCTATAGTGAGTCGTATTA
#target 1024MH
>IGHV2-5*02 8/TTGAGGG/1 IGHD2-21*01 2/G/2 IGHD3-22*01 3/CC/4 IGHJ6*02 [IGH]
GTAAAACGACGGCCAGTTCACCTTGAAGGAGTCTGGTCCTACGCTGGTGAAACCCACACAGACCCTCACGCT
GACCTGCACCTTCTCTGGGTTCTCACTCAGCACTAGTGGAGTGGGTGTGGGCTGGATCCGTCAGCCCCCAGG
AAAGGCCCTGGAGTGGCTTGCACTCATTTATTGGGATGATGATAAGCGCTACAGCCCATCTCTGAAGAGCAG
GCTCACCATCACCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGACAC
AGCCACATATTACTGTGCTTGAGGG
GCATATTGTGGTGGTGATTGCTATTGATTACTATGATAGTAGTGGTTATCACCC
CTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTA
AGCCCTATAGTGAGTCGTATTA
#target 1064OM
>IGHV4-39*01 1/TCCGACTTCCACTT/1 IGHD3-3*01 7/CCTCGTTGG/2 IGHJ4*02 [IGH]
GTAAAACGACGGCCAGTCCAGGACTGGTGAAGCCTCCGGAGACCCTGTCCCTCACCTGCACTG
TCTCTGGTGGCTCCATCAGCAGTAGTAGTTACTACTGGGGCTGGATCCGCCAGCCCCCAGGGAAGGGGCTGG
AGTGGATTGGGAGTATCTATTATAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTCACCATAT
CCGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCAGACACGGCTGTGTATT
ACTGTGCGAGAC
TCCGACTTCCACTT
TATTACGATTTTTGGAGTGGTTA
CCTCGTTGG
TACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAA
#target 1064OM
>IGHV5-10-1*03 0/CGCCG/6 IGHD2-21*02 3/AGGA/5 IGHJ4*02 [IGH]
TGGAGTCCGGAGCAGAGGTGAAAAAGCCCGGGGAGTCTCTGAGGATCT
CCTGTAAGGGTTCTGGATACAGCTTTACCAGCTACTGGATCAGCTGGGTGCGCCAGATGCCCGGGAAAGGCC
TGGAGTGGATGGGGAGGATTGATCCTAGTGACTCTTATACCAACTACAGCCCGTCCTTCCAAGGCCACGTCA
CCATCTCAGCTGACAAGTCCATCAGCACTGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCA
TGTATTACTGTGCGAGA
CGCCG
TTGTGGTGGTGACTGCTAT
AGGA
TTTCTCTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAGCCCTATAGTGAGTCGTATTA
#target 0956LC
>IGHV6-1*01 5/TCCCGATCGAGG/-6 IGHD3-10*01 -0/AACCT/-4 IGHJ6*02
GTAAAACGACGGCCAGTGTACAGCTGCAGCAGTCAGGTCCAGGACTGGTGAAGCCCTCGCAGACCCTCTCAC
TCACCTGTGCCATCTCCGGGGAC
AGTGTCTCTAGCAACAGTGCTGCTTGGAACTGGATCAGGCAGTCCCCATCGAGAGGCCTTGAGTGGCTGGGA
AGGACATACTACAGGTCCAAGTGGTATAATGATTATGCAGTATCTGTGAAAAGTCGAATAACCATCAACCCA
GACACATCCAAGAACCAGTTCTCCCTGCAGCTGAACTCTGTGACTCCCGAGGACACGGCTGTGTATTACTGT
GCA
TCCCGATCGAGG
CTATGGTTCGGGGAGTTATTATTAC
AACCT
CTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTA
AGCCCTATAGTGAGTCGTATTA
#target 0969JS
>IGHV5-51*03 0/TTGAGAAGGGTTTTT/5 IGHD6-13*01 2/CCC/6 IGHJ4*02
GTAAAACGACGGCCAGTAGGTGCAGCTGGTGGAGTCTGGAGCAGAGGTGAAAAAGCCGGGGGAGTCTCTGAAG
ATCTCCTGTAAGGGTTCTGGATACAGCTTTACCAGCTACTGGATCGGCTGGGTGCGCCAGATGCCCGGGAAA
GGCCTGGAGTGGATGGGGATCATCTATCCTGGTGACTCTGATACCAGATACAGCCCGTCCTTCCAAGGCCAG
GTCACCATCTCAGCCGACAAGTCCATCAGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACC
GCCATGTATTACTGTGCGAGACA
TTGAGAAGGGTTTTT
TAGCAGCAGCTGGT
CCC
TTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGT
#target 0969JS
>IGHV3-64*01 2/ACCCCCAGGTGAA/2 IGHD6-13*01 2/CCC/6 IGHJ4*02 [IGH]
GTAAAACGACGGCCAGTAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGAG
ACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAG
CTATGCTATGCACTGGGTCCGCCAGGCTCCAGGGAAGGGACTGGAATATGTTTCAGCTATTAGTAGTAATGG
GGGTAGCACATATTATGCAAACTCTGTGAAGGGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCT
GTATCTTCAAATGGGCAGCCTGAGAGCTGAGGACATGGCTGTGTATTACTGTGCGAGA
ACCCCCAGGTGAA
GTATAGCAGCAGCTGGT
CCC
TTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGT
#target 0990CE
>IGHV3-30*18 4/AAGATTCACCATA/21 IGHD32-21*01 0/GTCGGCCCC/2 IGHD3-22*01 7/CGC/10 IGHJ4*02 [IGH]
TGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCT
TCAGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCAT
ATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGA
ACACGCTGTATCTGCAA
ATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCG
AAAGATTCACCATA
CTATTCC
GTCGGCCCC
ATTACTATGATAGTAGTGGTTA
CGC
CTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAGCCCTATAGTGAGTCGTATTA
#target 1202LH
>IGHV5-51*01 1/GATC/4 IGHD7-27*01 0/TCCCAACATAGA/6 IGHJ6*03 [IGH]
AGTCTGGAGCAGAGGTGAAAAAGCCCGGGGAGTCTCTGAAGATCTCCTGTA
AGGGTTCTGGATACAGCTTTACCAGCTACTGGATCGGCTGGGTGCGCCAGATGCCCGGGAAAGGCCTGGAGT
GGATGGGGATCATCTATCCTGGTGACTCTGATACCAGATACAGCCCGTCCTTCCAAGGCCAGGTCACCATCT
CAGCCGACAAGTCCATCAGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATT
ACTGTGCGAGAC
GATC
CTGGGGA
TCCCAACATAGA
ACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAGGTA
AGCCCTATAGTGAGTCGTATTA
#target 1202LH
>IGHV3-15*01 13/TTTTTCCCC/15 IGHD3-22*01 8/GCCC/4 IGHJ4*02 [IGH]
CGCCTGGATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTGGCCGTATTA
AAAGCAAAACTGATGGTGGGACAACAGACTACGCTGCACCCGTGAAAGGCAGATTCACCATC
TCAAGAGATGATTCAAAAAACACGCTGTATCTGCAAATGAACAGCCTGAAAACCGAGGACAC
AGCCGTGTAT
TTTTTCCCC
TAGTGGTT
GCCC
CTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAG
CCCTATAGTGAGTCGTATTA
#target 0728LH
>IGKV3-15*01 0/GGGACCGACCGACG/9 KDE [IGK]
GGTTCAGTGGCAGTGGGTCTGGGACAGAGTTCACTCTCACCATCAGCAGCCTGCAGTCTGAAGATTTTGCAG
TTTATTACTGTCAGCAGTATAATAACTGGCCTCC
GGGACCGACCGACG
GTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 0732EC
>IGKV2D-30*01 17/AG/0 KDE [IGK]
ACAGTGATGGAACACCTACTTGAATTGGTTTCAGCAGAGGCCAGGCCAATCTCCAAGGCGCCTAATTTATAA
GGTTTCTAACTGGGACTCTGGGGTCCCAGACA
GATTCAGCGGCAGTGGGTCAGGCACTGATTTCACACTGAAAATCAGCAGGGTGGAGGCTGAGGATGTTGGGG
TTTATTACTGCATGCAAAGGGAGCCCTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
ATTTTTGCCATATCCACTATTTGGAGTCTGACCTCCCTAGGAAGCCTCCCTGCTCCCTAGGACAACCTGCTC
TGACCTCTGAGGACCTGTCTGTAAACGTCCAGAGAAAAGCATGTGCCTGAAGGGTCTATGAAGGGA
#target 0732EC
>Intron 2/GA/2 KDE [IGK]
ATAATTGCATTTTTTAATGACCGTGGGTCTGTGAAAAAAATAGGAAATATTTTAAAGAGTATGTTCTTTCAT
TATCCTCTGTTATTACTTGTCTACATTTTTATTCTGCCAAGAAGGCCGTGGCACCGCGAGCTGTAGACAGAG
CCGCGGTCTTTCTCGATTGAGTGGCTTTGGTGGCCATGCCACCGCGCTCTTGGGGCAGCCGCCTTGCCGCTA
GTGGCCGTGGCCACCCTGTGTCTGCCCGATTGATGCTGCCGTAGCCAGCTTTCCTGAGAAGCCCTAGTGGCA
GCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
ATTTTTGCCATATCCACTATTTGGAGTCTGACCTCCCTAGGAAGCCTCCCTGCTCCCTAGGACAACCTGCTC
#target 0862PT
>IGKV2-30*01 15/CAC/15 KDE [IGK]
GATTCAGTGGCAGTGGGTCAGGCACTGATTTCACACTGAAAATCAGCAGGGTGGAGGCTGAGGATGTTGGGG
TTTATTACTGCATGCAAGGCACGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 0931JS
>IGKV3-15*01 0/CCTTGGACCCC/0 KDE [IGK]
GGTTCAGTGGCAGTGGGTCTGGGACAGAGTTCACTCTCACCATCAGCAGCCTGCAGTCTGA
AGATTTTGCAGTTTATTACTGTCAGCAGTATAATAACTGGCCTCC
CCTTGGACCCC
GGAGCCCTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 0931JS
>Intron 2/AGGGGGT/4 KDE [IGK]
TTTTTTTTTTTTTTTTTTTTTTTCAAGCAGAAGACGGCATACGAGATCGAAGGACGTGACTGGAGTTCAGAC
GTGTGCTCTTCCGATCTGAGTGGCTTTGGTGGCCATGCCACCGCGCTCTTGGGGCAGCCGCCTTGCCGCTAG
TGGCCGTGGCCACCCTGTGTCTGCCCGATTAATGCTGCCGTAGCCAGCTTTCCTGA
AGGGGGT
CCCTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 0990CE
>IGKV4-1*01 0/CCACAAAT/16 KDE [IGK]
CGATTCAGTGGCAGCGGGTCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGGCTGAAGATGTGG
CAGTTTATTACTGTCAGCAATATTATAGTACTCCCCC
CCACAAAT
CCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 1012SP
>IGKV3-15*01 4/TTTACAGGGCTTCAC/0 KDE [IGK]
GGTTCAGTGGCAGTGGGTCTGGGACAGAGTTCACTCTCACCATCAGCAGCCTGCAGTCTGAAGATTTTGCAG
TTTATTACTGTCAGCAGTATAATAACTGGC
TTTACAGGGCTTCAC
GGAGCCCTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 1025TT
>IGKV2-24*01 0/TGT/19 KDE [IGK]
GATTCAGTGGCAGTGGGGCAGGGACAGATTTCACACTGAAAATCAGCAGGGTGGAAGCTGAGGATGTCGGGG
TTTATTACTGCATGCAAGCTACACAATTTCCTCATGTAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 1026TM
>IGKV1-39*01 1/GCGCCTTCTCCAGG/5 KDE [IGK]
AGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGTCTGCAACCTGAAGATTTTGCA
ACTTACTACTGTCAACAGAGTTACAGTACCCCTC
GCGCCTTCTCCAGG
CCTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 1026TM
>Intron 2/C/0 KDE [IGK]
TTTTTTTTTTTTTTTTTTTTTTTTTCAAGCAGAAGACGGCATACGAGATCACCGCTTGTGACTGGAGTTCAG
ACGTGTGCTCTTCCGATC
TGAGTGGCTTTGGTGGCCATGCCACCGCGCTCTTGGGGCAGCCGCCTTGCCGCTAGTGGCCGTGGCCACCCT
GTGTCTGCCCGATTAATGCTGCCGTAGCCAGCTTTCCTGAC
GGAGCCCTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 1089IH
>IGKV2-30*01 8/ACTGAGG/5 KDE [IGK]
GATTCAGTGGCAGTGGGTCAGGCACTGATTTCACACTGAAAATCAGCAGGGTGGAGGCTGAGGATGTTGGGG
TTTATTACTGCATGCAAGGTACACACACTGAGGCCTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAG
CTGC
#target 1163SC
>Intron 5/CCGTCATCC/1 KDE [IGK]
TTTTTTTTTTTTTTTTTTTTTCAAGCAGAAGACGGCATACGAGATGCTACTAGGTGACTGGAGTTCAGACGT
GTGCTCTTCCGATCTGAGTGGCTTTGGTGGCCATGCCACCGCGCTCTTGGGGCAGCCGCCTTGCCGCTAGTG
GCCGTGGCCACCCTGTGTCTGCCCGATTGATGCTGCCGTAGCCAGCTTTCC
CCGTCATCC
GAGCCCTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 1200CT
>IGKV1-17*01 3/CCC/16 KDE [IGK]
GGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACAATCAGCAGCCTGCAGCCT
GAAGATTTTGCAACTTATTACTGTCTACAGCATAATAGTTACCC
CCC
CCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 1203LL
>IGKV1-33*01 0/GCC/1 KDE [IGK]
GGGGTCCCATCAAGGTTCAGTGGAAGTGGATCTGGGACAGATTTTACTTTCACCATCAGCAGCCTGCAGCCT
GAAGATATTGCAACATATTACTGTCAACAGTATGATAATCTCCCTCC
GCC
GAGCCCTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 1203LL
>Intron 15/AG/14 KDE [IGK]
TTTTTTTTTTTTTTTTTTTTTTCAAGCAGAAGACGGCATACGAGATTTCACCGCGTGACTGGAGTTCAGACG
TGTGCTCTTCCGATCTGAGTGGCTT
TGGTGGCCATGCCACCGCGCTCTTGGGGCAGCCGCCTTGCCGCTAGTGGCCGTGGCCACCCTGTGTCTGCCC
GATTGATGCTGCCGTAGAGAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 1219NH
>IGKV2-28*01 0/A/11 KDE [IGK]
GATTCAGTGGCAGTGGATCAGGCACAGATTTTACACTGAAAATCAGCAGAGTGGAGGCTGAGGATGTTGGGG
TTTATTACTGCATGCAAGCTCTACAAACTCCTCC
AGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 1270BM
>Intron 0/GGGAGG/8 KDE [IGK]
TTTTTTTTTTTTTTTTTTTTTTTTTTCAAGCAGAAGACGGCATACGAGATACCTGGATGTGACTGGAGTTCA
GACGTGTGCTCTTCCGATCTG
AGTGGCTTTGGTGGCCATGCCACCGCGCTCTTGGGGCAGCCGCCTTGCCGCTAGTGGCCGTGGCCACCCTGT
GTCTGCCCGATTGATGCTGCCGTAGCCAGCTTTCCTGATG
GGGAGG
AGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 1270BM [IGK]
>IGKV1-8*01 10/TCCTCACCCGCCTAAGG/8 KDE
GGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCTGCCTGCAGTCT
GAAGATTTTGCAACTTATTACTGTCAACAGTATTATA
TCCTCACCCGCCTAAGG
AGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 0398AS
>TRBV27*01 29/CAAAG/3 JB2.7*02 [TRB]
tgaatgttgaggtgactgataagggagatgttcctgaagggtacaaagtctctcgaaaagagaagaggaatt
tccccctgatcctggagtcgcccagccccaaccagacccaaagctacgagcagtacttcgggccgggcacca
ggctcacggttacaggtaag
#target 0447GG
>TRBD2*02 1/AATG/0 TRBJ2-3*01 [TRB]
CAGGGCTGAGCGAACACCGGGGAGCTGTTTTTTGGAGAAGGCTCTAGGCTGACCGTACTGGGTAAGGAGGCG
GTTGGGGCTCCGGAGAGCTCCGAGAGGGCGGGATGGGCAGAGGTAAGCAGCTGCCCCACTCTGAGAGGGGCT
GTGCTGAGAGGTTTTTCCAAGCCCCACACAGTCAGACTAACCTCTGCCACCTGCGCTTCCTGCCGCTGCCCA
GTGGTTGGGGGAGGGGGACTAGCAGGGAGGAAACATTTTTGTATCATGGTGTAACATTGTGGGGACTAGCGG
GAGGAATGAGCACAGATACGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCGGTAAGCGGGGGCTCC
CGCTGAAGCCCCGGAACTGGGGAGGGGGCGCCCCGGGACGCCGGGGGCGTCGCAGGGCCAGTTTCTGTGCCT
T
#target 0465MB
>TRBD1*01 3/ATCCCG/0 TRBD2 4/0/4 TRBJ2-5*01 [TRB]
GCCAAACAGCCTTACAAAGACATCCAGCTCTAAGGAGCTCAAAACATCCTGAGGACAGTGCCTGGAGGTGAG
AAGGAAGCCCCCGGCCTGGTCCATACCCCACCACCAACTTGCATAATGGGGGGTGATGTCACCCACCCTCCA
CTCCCCTCAAAGGAGCAGCTGCTCTGGTGGTCTCTCCCAGGCTCTGGGGGCGGACCCATGGGAGGGGCTGTT
TTTGTACAAAGCTGTAACATTGTGGGGACAGGGATCCCGGGGACTAGCGGGAGAGACCCAGTACTTCGGGCC
AGGCACGCGGCTCCTGGTGCTCGGTGTGCGCG
#target 0639HA
>TRBV21-1*01 5/CGGGACTCCCCC/0 TRBD2*02 0/CCGGGGG/9 TRBJ2-7*01 [TRB]
AGAACTTATTCAGAAAGCAGAAATAATCAATGAGCGATTTTTAGCCCAATGCTCCAAAAACTCATCCTGTAC
CTTGGAGATCCAGTCCACGGAGTCAGGGGACACAGCACTGTATTTCTGTGCCAGCAGCCGGGACTCCCCCGG
GACTAGCGGGAGGGCCGGGGGGCAGTACTTCGGGCCGGGCACCAGGCTCACGGTTACAGGTAAG
#target 1166TW
>TRBD2*02 2/AGGTTCT/8 TRBJ2-2*01 [TRB]
TTTCCAAGCCCCACACAGTCAGACTAACCTCTGCCACCTGCGCTTCCTGCCGCTGCCCAGTGGTTGGGGGAG
GGGGACTAGCAGGGAGGAAACATTTTTGTATCATGGTGTAACATTGTGGGGACTAGCGGGAGAGGTTCT
GGGGAGCTGTTTTTTGGAGAAGGCTCTAGGCTGACCGTACTGGGTAAG
#target 1174OJ
>TRBD2*02 1/CG/6 TRBJ2-7*01 [TRB]
TTTCCAAGCCCCACACAGTCAGACTAACCTCTGCCACCTGCGCTTCCTGCCGCTGCCCAGTGGTTGGGGGAG
GGGGACTAGCAGGGAGGAAACATTTTTGTATCATGGTGTAACATTGTGGGGACTAGCGGGAGGCG
CGAGCAGTACTTCGGGCCGGGCACCAGGCTCACGGTTACAGGTAAG
#target 1235JBa
>TRBV21-1*01 3/GGA/1 TRBD2*01 7/5/6 TRBJ2-3*01 [TRB]
TTATGTTTACTGGTATCGTAAGAAGCTGGAAGAAGAGCTCAAGTTTTTGGTTTACTTTCAGAATGAAGAACT
TATTCAGAAAGCAGAAATAATCAATGAGCGATTTTTAGCCCAATGCTCCAAAAACTCATCCTGTACCTTGGA
GATCCAGTCCACGGAGTCAGGGGACACAGCACTGTATTTCTGTGCCAGCAGCAAGGAGGACTAGCTTTGG
GATACGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCGGTAAG
#target 1270BM
>TRBV27*01 8/TTTTCCCCC/7 TRBJ2-5*01 [TRB]
CTGGTATCGACAAGACCCAGGGCTGGGCTTAAGGCAGATCTACTATTCAATGAATGTTGAGGTGACTGATAA
GGGAGATGTTCCTGAAGGGTACAAAGTCTCTCGAAAAGAGAAGAGGAATTTCCCCCTGATCCTGGAGTCGCC
CAGCCCCAACCAGACCTCTCTGTACTTCTGTGCCAGCTTTTCCCCC
GACCCAGTACTTCGGGCCAGGCACGCGGCTCCTGGTGCTCGGTGAGCGCGGGCTGCTGGG
GCGCGGGCGCGGGCGGCTTGGGTCTGGTTTTTGCGGGGAGTCCCCGGGCTGTG
CTCTGGGGCCAACGTCCTGACTTTCGGGGCCGGCAGCAGGCTGACCGTGCTGGGCGAG
#target 1272BP
>TRBV21-1*01 4/TACTGGGAG/5 TRBD2*02 1/6/5 TRBJ2-7*01 [TRB]
GTATCGTAAGAAGCTGGAAGAAGAGCTCAAGTTTTTGGTTTACTTTCAGAA
TGAAGAACTTATTCAGAAAGCAGAAATAATCAATGAGCGATTTTTAGCCCAATGCTCCAAAAACTCATCCTG
TACCTTGGAGATCCAGTCCACGGAGTCAGGGGACACAGCACTGTATTTCTGTGCCAGCAGCAT
ACTGGGGAGTAGCGGGAGGTTCAGGACGAGCAGTACTTCGGGCCGGGCACCAGGCTCACGGTTACAGGTAAG
#target 1297RC
>TRBD2*01 2/CGGCTCTCACTA/2 TRBJ2-3*01 [TRB]
TTTCCAAGCCCCACACAGTCAGACTAACCTCTGCCACCTGCGCTTCCTGCCGCTGCCCAGTGGTTGGGGGAG
GGGGACTAGCAGGGAGGAAACATTTTTGTATCATGGTGTAACATTGTGGGGACTAGCGGGGGCGGCTCTCAC
TACACAGATACGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCGGTGTGCGCG
#target 1323DS
>TRBV5-1*01 0/TCCAC/8 TRBJ1-1*01 [TRB]
CAGTGTGTCCTGGTACCAACAGACCCCAGGACAGGGCCTTCAGTTCCTCTTTGAATACTTCAGTGAGACACA
GAGAAACAAAGGAAACTTCCCTGGTCGATTCTCAGGGCGCCAGTTCTCTAACTCTCGCTCTGAGATGAATGT
GAGCACCTTGGAGCTGGGGGACTCGGCCCTTTATCTTTGCGCCAGCAGCTTGGTCCAC
GAAGCTTTCTTTGGACAAGGCACCAGA
#target 1323DS
>TRBD2*01 0/CACTTTT/6 TRBJ2-7*01 [TRB]
TTTCCAAGCCCCACACAGTCAGACTAACCTCTGCCACCTGCGCTTCCTGCCGCTGCCCAGTGGTTGGGGGAG
GGGGACTAGCAGGGAGGAAACATTTTTGTATCATGGTGTAACATTGTGGGGACTAGCGGGGGGGCACTTTT
CGAGCAGTACTTCGGGCCGGGCACCAGGCTCACGGTTACAGGTAAG
# target 1266MN
>IGHD4-4*01 5/GCACGAGG/5 IGHJ5*02 [IGH]
AGATCCCCAGGACGCAGCACCACTGTCAATGGGGGCCCCAGACGCCTGGACCAGGGCCTGCGTGGGAAAGGC
CTCTGGGCACACTCAGGGGCTTTTTGTGAAGGGTCCTCCTACTGTGTGACTACAGTAGCACGAGGTGGTTCG
ACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAG
# target 1266MN
>IGHD7-27 0/TCAAG/0 IGHJ4 [IGH]
CACAGGCCCCCTACCAGCCGCAGGGTTTTGGCTGAGCTGAGAACCACTGTGCTAACTGGGGATCAAGACTAC
TTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAG
# target 1297RC
>IGHV2-70D*04 4/TCCCG/10 IGHD3-10*01 10/CCTTG/0 IGHJ5*02 [IGH]
gacctgcaccttctctgggttctcactcagcactagtggaatgcgtgcgagctggatccgtcagcccccagg
gaaggccctggagtggcttgcacgcattgattgggatgatgataaattctacagcacatctctgaagaccag
gctcaccatctccaaggacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacac
agccacgtattactgtgcacggtcccgggttcggggagccttgacaactggttcgacccctggggccaggga
accctgggccccctctcctcaggt
# target 1297RC
> IGHV3-74*01 1/0/11 IGHD6-6*01 0/CTCAA/12 IGHJ6*02 [IGH]
ctggatgcactgggtccgccaagctccagggaaggggctggtgtgggtctcacgtattaatagtgatgggag
tagcacaagctacgcggactccgtgaagggccgattcaccatctccagagacaacgccaagaacacgctgta
tctgcaaatgaacagtctgagagccgaggacacggctgtgtattactgtgcaagagctcgcccctcaaacta
cggtatggacgtctggggccaagggaccacggtcaccgtctcctcagg
# target 1297RC
> TRGV5*01 (-6) 6/CCCCCGGG/0 TRGJ1*02 [TRG]
tgccttctacatccactggtacctacaccaggaggggaaggccccacagcgtcttctgtactatgacgtctc
caactcaaaggatgtgttggaatcaggactcagtccaggaaagtattatactcatacacc
caggaggtggagctggatattgatactacgaaatctaattgaaaatgattctggggtctattactgtgccac
ctggcccccgggttattataagaaactctttggcagtggaacaacacttgttgtcacaggtaagtatcggaa
# target 1297RC
> TRBD2*01 2/CGGCTCTCACTA/2 TRBJ2-3 [TRB]
TTTCCAAGCCCCACACAGTCAGACTAACCTCTGCCACCTGCGCTTCCTGCCGCTGCCCAGTGGTTGGGGGAG
GGGGACTAGCAGGGAGGAAACATTTTTGTATCATGGTGTAACATTGTGGGGACTAGCGGGGGCGGCTCTCAC
TACACAGATACGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCGGTAAGCGGG
# target 1297RC
>TRDD2 0/CCACGGG/7 TRAJ9
AGGGGTATTGTGGATGGCAGCGGGTGGTGATGGCAAAGTGCCAAGGAAAGGGAAAAAGGAAGAAGAGGGTTT
TTATACTGATGTGTTTCATTGTGCCTTCCTACCCACGGGCTGGAGGCTTCAAAACTATCTTTGGAGCAGGAA
CAAGACTATTTGTTAAAGCAAGTAAGTTCCATGAAATAACCTGATTTATATTACAGTTGAAGAACATCTGTT
TTCATTGATTTTTTTCTTTTTAGGGGGAAGGGGACATAGTTTTGTCTGCCAGTTAAA
# target 1297RC
>TRDD2*01 1/AATCTGGGATT/0 TRDD3*01 4/AG/24 TRAJ53*01
AGGGGTATTGTGGATGGCAGCGGGTGGTGATGGCAAAGTGCCAAGGAAAGGGAAAAAGGAAGAAGAGGGTTT
TTATACTGATGTGTTTCATTGTGCCTTCCTAAATCTGGGATTACTGGGGGAAGAACTGACATTTGGAAAAGG
AACTCTCTTAACCGTGAATCCAAGTAAGTTTGAAGGGAGTGGGGGAAGGGGGAATTCAAACACTTCTGATTT
AATTACTTGCCCCTC
# target 1321HW
>IGHV3-30*01 7/GGG/18 IGHD2-21*02 1/GGGGG/2 IGHJ5*02 [IGH]
agctatgctatgcactgggtccgccaggctccaggcaaggggctagagtgggtggcagttatatcatatgat
ggaagtaataaatactacgcagactccgtgaagggccgattcaccatctccagagacaattccaagaacacg
ctgtatctgcaaatgaacagcctgagagctgaggacacggctgtgtattactgtgctgctattcaactggtt
cgacccctggggccagggaaccctggtcaccgtctcctcaggt
# target 1321HW
>IGKV4-1*01 3/0/0 KDE [IGK]
ACAGCTCCACAATAAGAACTACTTAGCTTGGTACCAGCAGAAACCAGGACAGCCTCCTAAGCTGCTCATTTA
CTGGGCATCTACCCGGGAATCCGGGGTCCCTGACCGATTCAGTGGCAGCGGGTCTGGGACAGATTTCACTCT
CACCATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAATATTATAGTACTCCGGAGCC
CTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGCATTTTTGCCATATCCA
# target 1321HW
>TRDV2*01 4/TACA/1 TRDD3 [TRD]
GGGTGACATTGATATTGCAAAGAACCTGGCTGTACTTAAGATACTTGCACCATCAGAGAGAGATGAAGGGTC
TTACTACTGTGCCTGTGATACACTGGGGGATACGCACAGTGCTACAAAACCTACAGAGACCTGTACAAAAAC
TGCAGGGGCAAAAG
# target 1321HW
>TRDV2*01 0/GGAGG/2 TRDD3 [TRD]
ATTGATATTGCAAAGAACCTGGCTGTACTTAAGATACTTGCACCATCAGAGAGAGATGAAGGGTCTTACTAC
TGTGCCTGTGACACCGGAGGTGGGGGATACGCACAGTGCTACAAAACCTACAGAGACCTGTACAAAAACTGC
AGGGGCAAAAGT
# target 1321HW
>TRDD2 4/T/2 TRDD3 [TRD]
AGGGGTATTGTGGATGGCAGCGGGTGGTGATGGCAAAGTGCCAAGGAAAGGGAAAAAGGAAGA
AGAGGGTTTTTATACTGATGTGTTTCATTGTGCCTTCTTGGGGGATACGCACAGTGCTACAAAACCTACAGA
GACCTGTACAAAAACTGCAGGGGCAAAAGTGCCATTTCCCTGGG
# target 1321HW
>TRDV2*01 4/TAC/0 TRDD3 5/TTTT/2 TRAJ9*01 [TRA+D]
TGCAAAGAACCTGGCTGTACTTAAGATACTTGCACCATCAGAGAGAGATGAAGGGTCTTACTACTGTGCCTG
TGATACACTGGGGGTTTTAAATACTGGAGGCTTCAAAACTATCTTTGGAGCAGGAACAAGACTATTTGTTAA
AGCAAGTAAGTTCCATGAAATAACCTGATTTATATTACAGTTGAAGAACATCTGTTTTCATTGATTTTTTTC
TTTTTAGGGGGAAGGGGACATAGTTTTGTCTGCCAGTTAAA
# target 0933KC
>IGHV3-7*01 0/TGGGGGTAG/4 IGHD2-2*01 3/CGGAC/3 [IGH]
GTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGATGGGGGTAGTAT
TGTAGTAGTACCAGCTGCTATCGGACACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCAC
# target 0933KC
>IGHV4-4 3/TTC/4 IGHD1-26*01 2/CCTCGGATTTTAAGA/9 IGHJ3*02 [IGH]
CTCTGTGACCGCCGCGGACACGGCCGTGTATTACTGTGCGAGTTCTAGTGGGAGCTACTCCTCGGATTTTAA
GAATATCTGGGGCCAAGGGACAATGGTCACCGTCTCCTCAAGTAAT
# target 0933KC
>TRDD2 4/A/3 TRDD3 [TRD]
AGGGGTATTGTGGATGGCAGCGGGTGGTGATGGCAAAGTGCCAAGGAAAGGGAAAAAGGAAGAAGAGGGTTT