Commit 89ba89a6 authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

tests: these sequences should be productive

parent 825730c2
...@@ -2,8 +2,8 @@ ...@@ -2,8 +2,8 @@
# This synthetic sequence ends after the end of the J gene, # This synthetic sequence ends after the end of the J gene,
# including a stop codon in all frames in that zone # including a stop codon in all frames in that zone
# end of the J gene @90 # end of the J gene @89
>TRGV9*01 0/CAT/0 TRGJP*01 0/17 >TRGV9*01 0/CA/0 TRGJP*01 0/17
acctactactgtgccttgtgggaggtgCAT acctactactgtgccttgtgggaggtgCA
tgggcaagagttgggcaaaaaaatcaaggtatttggtcccggaacaaagcttatcattacag tgggcaagagttgggcaaaaaaatcaaggtatttggtcccggaacaaagcttatcattacag
cccTAGcTAGcTAGccc cccTAGcTAGcTAGccc
...@@ -5,12 +5,15 @@ ...@@ -5,12 +5,15 @@
!LAUNCH: $VIDJIL_DIR/$EXEC -c designations -3 -V $VIDJIL_DIR/germline/homo-sapiens/TRGV.fa -J $VIDJIL_DIR/germline/homo-sapiens/TRGJ.fa $VIDJIL_DATA/productive_stop_after_J.fa !LAUNCH: $VIDJIL_DIR/$EXEC -c designations -3 -V $VIDJIL_DIR/germline/homo-sapiens/TRGV.fa -J $VIDJIL_DIR/germline/homo-sapiens/TRGJ.fa $VIDJIL_DATA/productive_stop_after_J.fa
!OUTPUT_FILE: out/productive_stop_after_J.vidjil !OUTPUT_FILE: out/productive_stop_after_J.vidjil
$ Clone name
1: "TRGV9.01 0/CA/0 TRGJP.01"
$ Correct number of start positions (no V, but J, cdr3 and junction)) $ Correct number of start positions (no V, but J, cdr3 and junction))
3: "start" 3: "start"
$ Correct stop position of TRGJP*01 $ Correct stop position of TRGJP*01
1: "stop": 92 1: "stop": 91
$ The sequence is productive $ The sequence is productive
f1: "productive": true 1: "productive": true
...@@ -24,5 +24,5 @@ $ Correct number of stop positions (10-1, no stop positions for J on the second ...@@ -24,5 +24,5 @@ $ Correct number of stop positions (10-1, no stop positions for J on the second
9: "stop" 9: "stop"
$ The two sequences are productive $ The two sequences are productive
f2: "productive": true 2: "productive": true
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment