tests: these sequences should be productive

algo/tests/data/productive_stop_after_J.fa

@@ -2,8 +2,8 @@
 # This synthetic sequence ends after the end of the J gene, 
 # including a stop codon in all frames in that zone
 
-# end of the J gene @90
->TRGV9*01 0/CAT/0 TRGJP*01 0/17
-acctactactgtgccttgtgggaggtgCAT
+# end of the J gene @89
+>TRGV9*01 0/CA/0 TRGJP*01 0/17
+acctactactgtgccttgtgggaggtgCA
 tgggcaagagttgggcaaaaaaatcaaggtatttggtcccggaacaaagcttatcattacag
 cccTAGcTAGcTAGccc

algo/tests/should-get-tests/productive_stop_after_J.should

@@ -5,12 +5,15 @@
 !LAUNCH: $VIDJIL_DIR/$EXEC -c designations -3 -V $VIDJIL_DIR/germline/homo-sapiens/TRGV.fa -J $VIDJIL_DIR/germline/homo-sapiens/TRGJ.fa $VIDJIL_DATA/productive_stop_after_J.fa
 !OUTPUT_FILE: out/productive_stop_after_J.vidjil
 
+$ Clone name
+1: "TRGV9.01 0/CA/0 TRGJP.01"
+
 $ Correct number of start positions (no V, but J, cdr3 and junction))
 3: "start"
 
 $ Correct stop position of TRGJP*01
-1: "stop": 92
+1: "stop": 91
 
 $ The sequence is productive
-f1: "productive": true
+1: "productive": true
 

algo/tests/should-get-tests/productive_stop_before_V.should

@@ -24,5 +24,5 @@ $ Correct number of stop positions (10-1, no stop positions for J on the second
 9: "stop"
 
 $ The two sequences are productive
-f2: "productive": true
+2: "productive": true