Attention une mise à jour du serveur va être effectuée le lundi 17 mai entre 13h et 13h30. Cette mise à jour va générer une interruption du service de quelques minutes.

Commit 88c3213c authored by Mathieu Giraud's avatar Mathieu Giraud

tests: update tests, -e 10 for Stanford_S22.fasta

With the new estimation of the p-value in affectanalyser.cpp, the following sequence
has a p-value on the J side of about 3.58e-04, yielding an e-value of about 4.71 (there are 13,153 reads in Stanford-S22).

Setting -e 10 enables thus this sequence to be still segmented.
Changing seeds could maybe change these results.

===

>lcl|FLN1FA001D7OE0.1
GGCCTGGAGTGGATTGGGTACATCTATTACAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTTGCCATATCGGTAGACACGTCTAAGAACCAGTTCTCCCTGAAGTTGAGCTCTGTGACTGCCGCGGACACGGCCGTGTATTATTGTGCGAGAGTAGCAGCGGCTGCTCTTGACTCCTTGGGGCCAGGGAAGCCTGGTCACCTCTCCTCAGG
73 + VJ      0 158 187 220    seed IGH SEG_+ 3.583786e-04 2.531831e-182/3.583786e-04
 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X _ _ _ _ _ _+X _ _ _ _ _ _ _+X _ _ _ _ _ _+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X _ _ _ _ _ _+X _ _ _ _ _ _+X+X ?+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X _ _ _ _+X+X+X _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _+x _ _ _ _ _ _+x _ _ _ _ _ _ _ _ _ _ _ _ _ _
parent 96eb0706
!REQUIRES: python ../../tools/check_python_version.py
!LAUNCH: ../../vidjil -z 1 -G ../../germline/IGH -w 60 -r 5 -b data ../../data/Stanford_S22.fasta ; cat out/data.vidjil | python ../../tools/format_json.py -1
!LAUNCH: ../../vidjil -z 1 -G ../../germline/IGH -w 60 -r 5 -e 10 -b data ../../data/Stanford_S22.fasta ; cat out/data.vidjil | python ../../tools/format_json.py -1
$ Number of reads
e1:"total": [13153]
......
!LAUNCH: ../../vidjil -y 0 -s '#####-#####' -w 100 -G ../../germline/IGH ../../data/Stanford_S22.fasta
!LAUNCH: ../../vidjil -e 10 -y 0 -s '#####-#####' -w 100 -G ../../germline/IGH ../../data/Stanford_S22.fasta
!LOG: stanford-w100.log
$ Find the good number of "too short sequences" for windows of size 100
......
!LAUNCH: ../../vidjil -z 0 -V ../../germline/IGHV.fa -D ../../germline/IGHD.fa -J ../../germline/IGHJ.fa -s \\\\#\\\\#\\\\#\\\\#\\\\#\\\\#-\\\\#\\\\#\\\\#\\\\#\\\\#\\\\# ../../data/Stanford_S22.fasta
!LAUNCH: ../../vidjil -e 10 -z 0 -V ../../germline/IGHV.fa -D ../../germline/IGHD.fa -J ../../germline/IGHJ.fa -s \\\\#\\\\#\\\\#\\\\#\\\\#\\\\#-\\\\#\\\\#\\\\#\\\\#\\\\#\\\\# ../../data/Stanford_S22.fasta
$ Parses IGHV.fa germline
1: 101627 bp in 348 sequences
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment