Commit 86aa229a authored by florian.thonier's avatar florian.thonier

should-vdj-test/0000-nec-* : names modifications to add alleles & gene

After correction, only 3 errors stay :
 - 2 DD2-DD3 not seen
 - 1 ambigous case
parent a36f0231
>TRBD2_8/10/2_TRBJ2-7
>TRBD2*02_8/10/2_TRBJ2-7*01
CTGCGCTTCCTGCCGCTGCCcaGTGGTTGGGGGAGGGGGACtaGCAGGGAGGAAACATTTTTGTATcaTGGTGTAACATTGTGGGGACTAGTGTCAGTCCCCCTACGAGCAGTACTTCGGGCCGGGCACCAGGCTCACGGTTACAGGTAAGA
>TRBD2-2_3/9/7_TRBJ2-1
>TRBD2*02_3/9/7_TRBJ2-1*01
CTGCGCTTCCTGCCGCTGCCcaGTGGTTggggGAGGGGGACtaGCAGGGAGGAAACATTTTTGTATATGGTGTAACATTGTGGGGACTAGCGGGAAGTAGGAGGAATGAgCAGTTCTTCGGGCCAGGGACACGGCTCACCGTGCTAGGTAAGAAGG
>TRBD2-01_2/26/2_TRBJ2-3
>TRBD2*01_2/26/2_TRBJ2-3*01
CTGCGCTTCCTGCCGCTGCCcaGTGGTTGGGGGAGGGGGACtaGCAGGGAGGAAACATTTTTGTATATGGTGTAACATTGTGGGGACTAGCGGGGGAGAAATTTCCAGTGTCACCTCCGTTACACAGATACGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCGGTAAGCGGG
\ No newline at end of file
>TRBV6-1_7/0/12_TRBD2_1/8/2_TRBJ2-7
>TRBV6-1*01 3/5/2 TRBJ2-7*01
GAGGGTACCACTGACAAAGGAGAAGTCCCCAATGGCTACAATGTCTCCAGATTAAACAAACGGGAGTTCTCGCTCAGGCTGGAGTCGGCTGCTCCCTCCCAGACATCTGTGTACTTCTGTGCCAGCAAGGTGAGTCCCCCTACGAGCAGTACTTCGGGCCGG
>TRBV7-2_3/1/0_TRBJ2-3
# AGC commun aux deux segments
>TRBV7-2*02 0/0/3 TRBJ2-3*01
TTACCCTTTACTGGTACCGGCAGAGGCTGGGGCAGGGCCTGGAGTTTTTAATTTACTTCCAAGGCAACAGTGCACCAGACAAATCAGGGCTGCCCAGTGATCGCTTCTCTGCAGAGAGGACTGGGGAATCCGTCTCCACTCTGACGATCCAGCGCACACAGCAGGAGGACTCGGCCGTGTATCTCTGTGCCAGCAGCTTTAGCACAGATACGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCGGTAAGCGGG
>TRBV_1/8/4_TRBJ2-7
>TRBV11-2*01 1/4/0 TRBJ2-7*01
AACGGTGTAGTGGATGATTCACAGTTGCCTAAGGATCGATTTTCTGCAGAGAGGCTCAAAGGAGTAGACTCCACTCTCAAGATCCAGCCTGCAAAGCTTGAGGACTCGGCCGTGTATCTCTGTGCCAGCAGCTTAGGTCCCTCGTACGAGCAGTACTTCGGGCCGGGCACCAGGCTC
>TRDD2_3/7/0_TRDD3
gcgGGTGGtGATGGCAAAGTGCCAAGGAAAGGGAAAAAGGAAGAAGAGGGTTTTTATACTGATGTGTTTCATTGTGCCTTCCCCCCCCTACTGGGGGAtACGCACAGTGCTACAAAACCTACAgAGACCTGTACAAAAACTGCAGGGGCAAAAGTGCCATTTCCCTGGGATATCCTCACCCTGGGTcCcaaa
>TRDD2_0/4/3_TRDD3_0/2/3_TRDJ1
# double DD non detecte
>TRDD2*01_0/4/3_TRDD3_0/2/3_TRDJ1*01
AgcgggtggtgatggcaaagtgccaaggaaagggaaaaaggaagaagagggtttttatactgatgTGTTTCATTGTGCCTTCCTACGTGAGGGGGATACGCCCCGATAAACTCATCTTTGGAAAAGGAACCCGTGTGACTGTGGAAC
>TRDV5_3/8/3_TRDD2_1/0/3_TRDD3_0/0/2_TRDJ1
# double DD non detecte
>TRAV29/DV5*01_3/8/3_TRDD2_1/0/3_TRDD3_0/0/2_TRDJ1
cattAggtAAAAATGaagatGGAAGATTCACTGTCTTCTTAAACAAAAGTGCCAAGCACCtctcTctGCACATTGTGCCCTCCCAGCCTGGAGACTCTGCAGTGTACTTCTGTGCAGCAACACCGAGATCCTAGGGGGATACgACCGATAAACTCATCTTTGGAAAAGGAACCCGTGTGACTGTGgAACa
\ No newline at end of file
>TRDV1_0/1/4_TRDD3_4/11/0_TRDJ1
>TRDV1*01_0/0/3_TRDD3_4/11/0_TRDJ1*01
CAAAAAGTGGTCGCTATTCTGTCAACTTCAAGAAAGCAGCGAAATCCGTCGCCTTAACCATTTCAGCCTTACAGCTAGAAGATTCAGCAAAGTACTTTTGTGCTCTTGGGGAACTAGGGGACTGGTCCCCTTACACCGATAAACTCATCTTTGGAAAAGGAACCCGTGTGACTGTGGAAc
>TRDV5_0/9/0_TRDD3_0/9/2_TRDJ1
>TRAV29/DV5*01_0/9/0_TRDD3_3/9/2_TRDJ1*01
GAtAAAAATGAAGatGGAAGaTTcaCTGTCTTCTTAAAcAAAAGTGCcaAGCACCTCTCTCTGCACATTGTGCCCTCCCAGCCTGGAGACTCTGCAGTGTACTTCTGTGCAGCAAGCGCGAATCCTGACTGGGGGATCGAGGGGGAACCGATAAACTCATCTTTGGAAAAGGAACCCGTGTGACTGTGGAACA
>TRDV1_5/14/0_TRDJ1
>TRDV1_5/14/0_TRDJ1*01
GCCttAcAGCtAGAAgattcAGCAAaGtACtnttGtGCtCttGGGACCCtttCCcGtGtACACCGATAAACtCAtCtttGGAAAAgGAACCCGtGtGACtGTGGAACA
\ No newline at end of file
>TRGV4_3/15/2_TRGJ1-1
>TRGV4_3/15/2_TRGJ1*01
GCGTCTTCTGTacTATGACTCCTACACCTCcaGCGTTGTGTTGGAATcaGGAATcaGCCCAGGGAAGTATGATACTTATGGAAGCACAAGGAAgAACTTGAGAATGATACTGCGAAATCTTATTGAAAATGACTCTGGAGTCTATTACTGTGCCACCTGGGATAAGGAGGGACATAAgATTATTATAAGAAACTCTTTGGCAGTGGAACAACACTGGTTGTCACAGGTA
>TRGV11_2/5/0_TRGJ1
TGGTGTACCaCTGTGCcTGCtgGaTTAGGCTCCTAGAATTATTATAAGAAACTCTTTGGCAGTGGAACAACACTGGTTGTCACAGGTaagtatcggaagaatacaacattccaaggtaatagagggaaagcaggaa
>TRGV10_14/18/1_TRGJ1-1
# arbitrage difficile
>TRGV10*01_14/18/1_TRGJ1*01
ATCCtttACcaTCaAGtCCGtAGAGAAAGAAGACAtGGCCGTttACTACtGtGCtACCGCtGGAgGtCCttACAAttAtTAtAAGAAACtCTttGGCAGTGGAACAACACtGGTtGTCACAGGTA
\ No newline at end of file
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment