Commit 84f2acae authored by Mikaël Salson's avatar Mikaël Salson Committed by Mathieu Giraud
Browse files

gosh-igh: several possible recombinations

Use the alternate syntax to take them into account
parent 14847dd7
...@@ -99,7 +99,13 @@ GTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGATGGAAGC ...@@ -99,7 +99,13 @@ GTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGATGGAAGC
ACCCCMTGTCCAGTCCTGGGGGCCCCTGGCACAGCTGTCTGGACCCTCTCTATTCCCTGGGAAGCTCCYCCTGACAGCCCCGCCTCCAGTTCCAGGTGTGGTTATTGTCAGGGGGTGTCAGACTGTGGTGGATACAGCTATGACCCCCCCAAAGACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAGG ACCCCMTGTCCAGTCCTGGGGGCCCCTGGCACAGCTGTCTGGACCCTCTCTATTCCCTGGGAAGCTCCYCCTGACAGCCCCGCCTCCAGTTCCAGGTGTGGTTATTGTCAGGGGGTGTCAGACTGTGGTGGATACAGCTATGACCCCCCCAAAGACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAGG
#1411 vh1 #1411 vh1
>IGHV1-58*02 2/13/0 IGHD3-10*01 2/0/3 IGHJ4*02 [IGH] # sequence: GTGTATTACTGTGCGGCATCCTCCTTGGTAGGTATTACTATGGTTCGGGGAGTTATTATAACTTTGACTACTGGGGCCAGGGAACGCTGGTCACCGTC
# ||||||||||||||||||
# IGHV1-58*02 GTGTATTACTGTGCGGCAGA |||||||||||||||||||||||||||||||
# IGHD3-10*01 GTATTACTATGGTTCGGGGAGTTATTATAAC
||||||||||||||||||
# IGHJ4*02 ACTACTTTGACTACTGGGGCC
>IGHV1-58*02 2/13/0 IGHD3-10*01 (2/0/3, 1/0/4, 0/0/5) IGHJ4*02 [IGH]
CGGCAGTCTCCTGCAGGCTTCTGGATTCACCTTTACTAGCTCTGCTATGCAGTGGGTGCGACAGGCTCGTGGACAACGCCTTGAGTGGATAGGATGGATCGTCGTTGGCAGTGGTAACACAAACTACGCACAGAAGTTCCAGGAAAGAGTCACCATTACCAGGGACATGTCCACAAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCCGAGGACACGGCCGTGTATTACTGTGCGGCATCCTCCTTGGTAGGTATTACTATGGTTCGGGGAGTTATTATAACTTTGACTACTGGGGCCAGGGAACGCTGGTCACCGTCTCCTCAGGTAAA CGGCAGTCTCCTGCAGGCTTCTGGATTCACCTTTACTAGCTCTGCTATGCAGTGGGTGCGACAGGCTCGTGGACAACGCCTTGAGTGGATAGGATGGATCGTCGTTGGCAGTGGTAACACAAACTACGCACAGAAGTTCCAGGAAAGAGTCACCATTACCAGGGACATGTCCACAAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCCGAGGACACGGCCGTGTATTACTGTGCGGCATCCTCCTTGGTAGGTATTACTATGGTTCGGGGAGTTATTATAACTTTGACTACTGGGGCCAGGGAACGCTGGTCACCGTCTCCTCAGGTAAA
#1400 vh2 #1400 vh2
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment