Commit 84e52850 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: mark as BUG a sequence from the previous commits

parent 4866f857
......@@ -10,8 +10,8 @@ OTHER_SRC=$(wildcard unit-tests/*.cpp)
LIB=../core/vidjil.a ../lib/lib.a
SHOULD=$(wildcard should-get-tests/*.should-get)
SHOULD_LOG=$(SHOULD:.should-get=.tap)
SHOULD_VDJ_EXPECTED_FAILS=--expected-fails 85
SHOULD_LOCUS_EXPECTED_FAILS=--expected-fails 2
SHOULD_VDJ_EXPECTED_FAILS=--expected-fails 84
SHOULD_LOCUS_EXPECTED_FAILS=--expected-fails 3
SHOULD_VDJ=$(wildcard should-vdj-tests/*.should-vdj.fa)
SHOULD_LOCUS=$(wildcard should-vdj-tests/*.should-locus.fa)
SHOULD_VDJ_TO_TAP=python -u should-vdj-to-tap.py
......
>IGHV1-18*01 0//0 IGHD1-1*01 0//0 IGHJ1*01 [IGH] BUG
>IGHV1-18*01 0//0 IGHD1-1*01 0//0 IGHJ1*01 [IGH]
actgtgcgagaga
ggtacaactggaacgac
gctgaatacttcc
>IGHV1-18*01 0//0 IGHD3-16*01 0//0 IGHJ4*01
>IGHV1-18*01 0//0 IGHD3-16*01 0//0 IGHJ4*01 [IGH]
agcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagaga
gtattatgattacgtttgggggagttatgcttatacc
actactttgactactggggccaaggaaccctggtcaccgtctcctcag
# Same sequence, but with only the 20bp start of J
>IGHV1-18*01 0//0 IGHD3-16*01 0//0 IGHJ4*01
>IGHV1-18*01 0//0 IGHD3-16*01 0//0 IGHJ4*01 [IGH] BUG
agcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagaga
gtattatgattacgtttgggggagttatgcttatacc
actactttgactactggggcc
# Same sequence, but with only the 15bp start of J
>IGHV1-18*01 0//0 IGHD3-16*01 0//0 IGHJ4*01
>IGHV1-18*01 0//0 IGHD3-16*01 0//0 IGHJ4*01 [IGH]
agcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagaga
gtattatgattacgtttgggggagttatgcttatacc
actactttgactactg
\ No newline at end of file
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment