Commit 83a82c10 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: update tests for format_json.py

.json elements are sorted now by keys.
parent cb1106a3
!LAUNCH: ../../vidjil -G ../../germline/IGH -r 5 -b data ../../data/Stanford_S22.fasta ; cat out/data.vidjil | python ../../tools/format_json.py !LAUNCH: ../../vidjil -G ../../germline/IGH -r 5 -b data ../../data/Stanford_S22.fasta ; cat out/data.vidjil | python ../../tools/format_json.py -1
$ Number of reads $ Number of reads
e1:"total": [13153], e1:"total": [13153]
$ Number of segmented reads $ Number of segmented reads
e1:"segmented": [13139] e1:"segmented": [13139]
$ Most abundant window $ Most abundant window
e1:"id": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC", "reads": [8] 1:"id": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC".*"reads": \\[8\\]
!LAUNCH: ../../vidjil -G ../../germline/IGH ../../data/Stanford_S22.fasta ; python ../../tools/fuse.py out/Stanford_S22.vidjil out/Stanford_S22.vidjil -o out/fused.data ; cat out/fused.data | python ../../tools/format_json.py !LAUNCH: ../../vidjil -G ../../germline/IGH ../../data/Stanford_S22.fasta ; python ../../tools/fuse.py out/Stanford_S22.vidjil out/Stanford_S22.vidjil -o out/fused.data ; cat out/fused.data | python ../../tools/format_json.py -1
$ Points list $ Points list
e1:"original_names": ["../../data/Stanford_S22.fasta", "../../data/Stanford_S22.fasta"] e1:"original_names": ["../../data/Stanford_S22.fasta", "../../data/Stanford_S22.fasta"]
$ Most abundant window, twice, fused $ Most abundant window, twice, fused
1:"reads": \\[8, 8\\].*"id": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC"},.*"top": 2 1:"id": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC".*"reads": \\[8, 8\\].*"top": 2
# Fails since 49046ca6b97, no more 'others' # Fails since 49046ca6b97, no more 'others'
$ Windows that are not in the top 50 $ Windows that are not in the top 50
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment