Commit 80c0b57b authored by Mathieu Giraud's avatar Mathieu Giraud

test: another test, stop codon after end of the J gene

parent 151e21c1
# This synthetic sequence ends after the end of the J gene,
# including a stop codon in all frames in that zone
# end of the J gene @90
>TRGV9*01 0/CAT/0 TRGJP*01 0/17
acctactactgtgccttgtgggaggtgCAT
tgggcaagagttgggcaaaaaaatcaaggtatttggtcccggaacaaagcttatcattacag
cccTAGcTAGcTAGccc
## Now a productive sequence, with a stop codon after a TRGJ gene
## We now use -J ../TRGJ.fa, see #3147
!LAUNCH: $VIDJIL_DIR/$EXEC -c designations -3 -V $VIDJIL_DIR/germline/homo-sapiens/TRGV.fa -J $VIDJIL_DIR/germline/homo-sapiens/TRGJ.fa $VIDJIL_DATA/productive_stop_after_J.fa
!OUTPUT_FILE: out/productive_stop_after_J.vidjil
$ Correct number of start positions (no V, but J, cdr3 and junction))
3: "start"
$ Correct stop position of TRGJP*01
1: "stop": 92
$ The sequence is productive
f1: "productive": true
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment