Commit 7f0afb69 authored by Mikaël Salson's avatar Mikaël Salson

segmenter_test.js: A test doesn't have to update the segmenter or model by itself

parent 0c83ea37
......@@ -127,7 +127,6 @@ QUnit.test("segt", function (assert) {
assert.deepEqual(segment.sequence[3].get_positionned_highlight("test_feature",""),{"color": "", "css": "highlight_seq", "seq": "CACCCAGGAGGTGGAGCTGGATATTGAGACT", "start": 94, "stop": 124, "tooltip": ""}, "test feature value")
assert.equal(m.clone(3).getSegLength('test_feature'),31, "feature length");
m.unselectAll();
segment.updateElem([])
assert.equal(segment.toFasta(), "");
m.select(3);
assert.equal(segment.toFasta(), "> test4 // 2.500%\nGGAAGGCCCCACAGCGTCTTCTGTACTATGACGTCTCCACCGCAAGGGATGTGTTGGAATCAGGACTCAGTCCAGGAAAGTATTATACTCATACACCCAGGAGGTGGAGCTGGATATTGAGACTGCAAAATCTAATTGAAAATGATTCTGGGGTCTATTACTGTGCCACCTGGGACAGGCTGAAGGATTGGATCAAGACGTTTGCAAAAGGGACTAGGCTCATAGTAACTTCGCCTGGTAA\n", "fasta seq ")
......
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment