Commit 7c669e5d authored by Mathieu Giraud's avatar Mathieu Giraud

tests: typo in a gene name

parent 0ae4e1e6
......@@ -8,6 +8,6 @@ gaattattataagaaactctttggcagtggaacaacactggttgtcacag
ttacagctagaagattcagcaaagtacttttgtgctcttggggaact
gctgaatacttccagcactggggccagggcaccctggtcaccgtctcctcag
>IGKV1-12*01--IGKL1*01 (revcomp)
>IGKV1-12*01--IGLJ1*01 (revcomp)
ctaggacggtgaccttggtcccagttccgaagacataa
ggagggaaactgttagcctgttgacaatagtaagttgcaaaatcttc
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment