MAJ terminée. Nous sommes passés en version 14.6.2 . Pour consulter les "releases notes" associées c'est ici :

https://about.gitlab.com/releases/2022/01/11/security-release-gitlab-14-6-2-released/
https://about.gitlab.com/releases/2022/01/04/gitlab-14-6-1-released/

Commit 7c479e01 authored by BibloLeHibou's avatar BibloLeHibou
Browse files

clone export : update functionnal test after bug correction (link to #2628)

parent c0dc8c3c
Pipeline #6968 passed with stages
in 2 minutes and 28 seconds
...@@ -294,7 +294,7 @@ class TestMultilocus < BrowserTest ...@@ -294,7 +294,7 @@ class TestMultilocus < BrowserTest
assert ( $b.window(:title => "").exists? ) , ">> fail opening fasta export " assert ( $b.window(:title => "").exists? ) , ">> fail opening fasta export "
$b.window(:title => "").use do $b.window(:title => "").use do
assert ($b.text.include? ">TRBV29*01 -1/0/-0 TRBD1*01 -2/0/-5 TRBJ2-5*01"), "header name" assert ($b.text.include? ">TRBV29*01 -1/0/-0 TRBD1*01 -2/0/-5 TRBJ2-5*01"), "header name"
assert ($b.text.include? "YYGGGYYACGYAYAGCGGYGYTTYYCCTYTYTGYTYTGCYAAAYAACYYYYTGTGYCTYTGTGCYGYGTTYCCCGGYYYAAACYCYCYYCCTYG\nGCYAGGYCYGG"), "sequence" assert ($b.text.include? "YYGGGYYACGYAYAGCGGYGYTTYYCCTYTYTGYTYTGCYAAAYAACYYYYTGTGYCTYTGTGCYGYGTTYCCCGGYYYAAACYCYCYYCCTYGG\nCYAGGYCYGG"), "sequence"
end end
end end
......
...@@ -101,7 +101,7 @@ GGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTACGACAT ...@@ -101,7 +101,7 @@ GGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTACGACAT
$b.window(:title => "").use do $b.window(:title => "").use do
assert ($b.text.index(/TRGV5.*200 nt/) > 0), "header name" assert ($b.text.index(/TRGV5.*200 nt/) > 0), "header name"
assert ($b.text.index(/IGHV3-13.*374 nt/) > 0), "header name" assert ($b.text.index(/IGHV3-13.*374 nt/) > 0), "header name"
assert ($b.text.include? "CCTGG\nGGGGCCA\nGATT"), "sequence" assert ($b.text.include? "CCTGGG\nGGGCCAG\nATT"), "sequence"
end end
end end
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment