Commit 7c2ded9b authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

README: there is no clustalw by default (no very_detailed_cluster_analysis)

parent 6ba3b43f
......@@ -62,7 +62,8 @@ make test # run self-tests
### Optional dependencies
clustalw (to compute alignments between windows from a same clone)
clustalw (to compute alignments between windows from a same clone, by setting
very_detailed_cluster_analysis in vidjil.cpp)
neato (to display graph of neighbors for the automatic clusterisation)
### Vidjil parameters
......@@ -118,7 +119,7 @@ CTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTACTACATGGACGTCTG
# then gather them into clones (-R 1, with at least 1 read each:
# there are many 1-read clones due to sequencing errors.)
# A more natural option could be -R 5.
# No representative selection / clustalw postprocessing (-x)
# No representative selection (-x)
# Results are in out/segmented.fa, out/windows.fa-* and out/clones*
# out/segmented.fa list segmented reads using the .vdj format (see below)
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment