Commit 7a274ccc authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

test: update tests

Follows 851b7931.
parent dda6864d
......@@ -122,10 +122,10 @@ QUnit.test("segt", function (assert) {
var h = segment.sequence[3].get_positionned_highlight('f1','');
assert.equal(h.start,-1, " start feature value");
assert.equal(h.stop, -1, "stop feature value");
assert.deepEqual(segment.sequence[3].get_positionned_highlight("test_feature",""),{"color": "", "css": "highlight_seq", "seq": "undefinedCACCCAGGAGGTGGAGCTGGATATTGAGACT", "start": 94, "stop": 124, "tooltip": ""}, "test feature value")
assert.deepEqual(segment.sequence[3].get_positionned_highlight("test_feature",""),{"color": "", "css": "highlight_seq", "seq": "CACCCAGGAGGTGGAGCTGGATATTGAGACT", "start": 94, "stop": 124, "tooltip": ""}, "test feature value")
assert.equal(m.clone(3).getSegLength('test_feature'),31, "feature length");
m.select(3);
assert.equal(segment.toFasta(), "> test4 // 2.500%\nGGAAGGCCCCACAGCGTCTTCTGTACTATGACGTCTCCACCGCAAGGGATGTGTTGGAATCAGGACTCAGTCCAGGAAAGTATTATACTCATACACCCAGGAGGTGGAGCTGGATATTGAGACTGCAAAATCTAATTGAAAATGATTCTGGGGTCTATTACTGTGCCACCTGGGACAGGCTGAAGGATTGGATCAAGACGTTTGCAAAAGGGACTAGGCTCATAGTAACTTCGCCTGGTAA", "fasta seq ")
assert.equal(segment.toFasta(), "> test4 // 2.500%\nGGAAGGCCCCACAGCGTCTTCTGTACTATGACGTCTCCACCGCAAGGGATGTGTTGGAATCAGGACTCAGTCCAGGAAAGTATTATACTCATACACCCAGGAGGTGGAGCTGGATATTGAGACTGCAAAATCTAATTGAAAATGATTCTGGGGTCTATTACTGTGCCACCTGGGACAGGCTGAAGGATTGGATCAAGACGTTTGCAAAAGGGACTAGGCTCATAGTAACTTCGCCTGGTAA\n", "fasta seq ")
assert.ok(segment.isDNA('CACCCAGGAGGTGGAGCTGGATATTGAGACT'), "test dna")
assert.ok(segment.isAA('CACCCAGGAGGTGGAGCTGGATATTGAGACT'), "test AA")
assert.ok(segment.isPos(h), "test if an object contain pos")
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment