Commit 7a274ccc authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

test: update tests

Follows 851b7931.
parent dda6864d
...@@ -122,13 +122,13 @@ QUnit.test("segt", function (assert) { ...@@ -122,13 +122,13 @@ QUnit.test("segt", function (assert) {
var h = segment.sequence[3].get_positionned_highlight('f1',''); var h = segment.sequence[3].get_positionned_highlight('f1','');
assert.equal(h.start,-1, " start feature value"); assert.equal(h.start,-1, " start feature value");
assert.equal(h.stop, -1, "stop feature value"); assert.equal(h.stop, -1, "stop feature value");
assert.deepEqual(segment.sequence[3].get_positionned_highlight("test_feature",""),{"color": "", "css": "highlight_seq", "seq": "undefinedCACCCAGGAGGTGGAGCTGGATATTGAGACT", "start": 94, "stop": 124, "tooltip": ""}, "test feature value") assert.deepEqual(segment.sequence[3].get_positionned_highlight("test_feature",""),{"color": "", "css": "highlight_seq", "seq": "CACCCAGGAGGTGGAGCTGGATATTGAGACT", "start": 94, "stop": 124, "tooltip": ""}, "test feature value")
assert.equal(m.clone(3).getSegLength('test_feature'),31, "feature length"); assert.equal(m.clone(3).getSegLength('test_feature'),31, "feature length");;;
assert.ok(segment.isDNA('CACCCAGGAGGTGGAGCTGGATATTGAGACT'), "test dna") assert.ok(segment.isDNA('CACCCAGGAGGTGGAGCTGGATATTGAGACT'), "test dna")
assert.ok(segment.isPos(h), "test if an object contain pos") assert.ok(segment.isPos(h), "test if an object contain pos")
assert.deepEqual(segment.findPotentialField(),["", "cdr3", "fr1", "5", "test_feature", "id", "f1", "V-REGION", "J-REGION", "D-REGION", "CDR3-IMGT"], "find field to highlight") assert.deepEqual(segment.findPotentialField(),["", "cdr3", "fr1", "5", "test_feature", "id", "f1", "V-REGION", "J-REGION", "D-REGION", "CDR3-IMGT"], "find field to highlight")
}) })
\ No newline at end of file
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment