Commit 77f94620 authored by Mikaël Salson's avatar Mikaël Salson
Browse files

0000-nck-TRB.should-vdj.fa: Typo in the designation

Ambiguous terms should be surrounded by parentheses
parent 63ce9c60
......@@ -10,7 +10,7 @@ OTHER_SRC=$(wildcard unit-tests/*.cpp)
LIB=../core/vidjil.a ../lib/lib.a
SHOULD=$(wildcard should-get-tests/*.should-get)
SHOULD_LOG=$(SHOULD:.should-get=.tap)
SHOULD_VDJ_EXPECTED_FAILS=--expected-fails 84
SHOULD_VDJ_EXPECTED_FAILS=--expected-fails 83
SHOULD_LOCUS_EXPECTED_FAILS=--expected-fails 3
SHOULD_VDJ=$(wildcard should-vdj-tests/*.should-vdj.fa)
SHOULD_LOCUS=$(wildcard should-vdj-tests/*.should-locus.fa)
......
......@@ -11,7 +11,7 @@ AACGGTGTAGTGGATGATTCACAGTTGCCTAAGGATCGATTTTCTGCAGAGAGGCTCAAAGGAGTAGACTCCACTCTCAA
##############################################
>TRBV10-2*01 4/CC/3 TRBD2*01 7//5,8//4 TRBJ1-2*01 [TRB]
>TRBV10-2*01 4/CC/3 TRBD2*01 (7//5,8//4) TRBJ1-2*01 [TRB]
GCTGATATTACAGATAAAGGAgAAGTCCCCGATGGCTATGTTGTCTCCAGATCCAAGACAGAGAATtTCCCCCTCACTCTGGAGTCaGCtACCCGCTCCCAgACATCTGTGTATTTCTGCGCCaGCAGTGCCACTAgCTaTGGCTACACCTTCGGTTCGGGGACCAGGTTAACCGTTGTAGGTAAG
# verifier seq
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment