Commit 77734929 authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

Merge branch 'feature-a/2964-add-test' into 'dev'

Add a test with constant gene in the sequence to check we detect it

See merge request !604
parents 4ec24edd d028ce42
Pipeline #121522 failed with stages
in 7 minutes and 58 seconds
>IGHV2-26*01 IGHJ4*02 [IGH]
TTCTCCACAGGGGTCTTGTCCCAGGTCACCTTGAAGGAGTCTGGTCCTGTACTGGTTAAACCCACAGAGACCCTCACGCTGACGTGCACCGTCTCTGGGTTCTCACTCAACAGTGCTAGAATGGGTGTGACCTGGATCCGTCAGTCCCCAGGGAAGGCCCTGGAATGGCTTGCACACATTTCCTCGAATGACGAAAAATTGTATAGTACATCTCTGAAGACCAGGCTCACCATCTCCAAGGACACCTCCAGAAGCCAGGTGGTCCTCACCGTGACCAACATGGACCCTGTGGACACAGCCACATATTACTGTGCACGGACAC
GGGGAGTATATAGTTATGATTCTC
TTGAGTACTGGGGCCAGGGAGCCCTGATCACCGTCTCCGCAGGGAGTGCATCCGCCCCAACCCTTTTCCCCCTCGTCTCCTGTGAGAATTCCCCGTC
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment