Une MAJ de sécurité est nécessaire sur notre version actuelle. Elle sera effectuée lundi 02/08 entre 12h30 et 13h. L'interruption de service devrait durer quelques minutes (probablement moins de 5 minutes).

Commit 76e8be96 authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

tests: three mutations makes it difficult to recognize a V

Perversely chosen mutations may fool our best heuristics.
See #3297 and #3298.
parent 2c19fe92
Pipeline #31858 passed with stages
in 51 seconds
# Here TRGV1*01 should be strictly better than TRGV5P*01
# #####-#####
# X X X
# V1*01 aagcacaaggagcaattggaatttgagactgcaaaatctaattaaaaatgattctgggttctattactgtgccacctgggacagg
# aagcacaaggagcaaCtggaatttgagactgcaaaatctaattGaaaatgattctgggGtctattactgtgccacct
# V5P*01 accgaggaggtggagCtggaatttgagactgcaaaatctaattgaaaatgattctggggtctattactgtgccacctggggcagg
# XXX XX X X X= = = !
>TRGV1*01 8/AAAA/0 TRGJ1*01 - 3 mutations in V1
>TRGV1*01 8/AAAA/0 TRGJ1*01 - 2 mutations in V1
>TRGV1*01 8/AAAA/0 TRGJ1*01 - 1 mutation in V1
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -c segment -g $VIDJIL_DIR/germline/homo-sapiens.g $VIDJIL_DATA/what-V.fa
$ V1*01 is recognized three times
3: VJ .* TRGV1.01
$ V8 and V5P are never recognized
0: VJ .* TRGV8
0: VJ .* TRGV5P
$ N region and J1*01 are properly analyzed
3: 8/AAAA/0 TRGJ1.01
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment