Commit 7675f014 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: add tests, gapped J sequences

J downstream sequences should also be gapped.
See #3002.
parent aef329be
Pipeline #16234 passed with stages
in 24 seconds
!LAUNCH: (cd $VIDJIL_DIR/germline ; cat homo-sapiens/TRAJ.fa | tr '|' '#' )
$ Correct gapped sequence (TRAJ11*01, regular case)
1: ^[.]{9}tgaattcaggatacagcaccctcacctttgggaaggggactatgcttctagtctctccag
$ Correct gapped sequence (TRAJ16*01, special hard-coded case)
1: ^[.]{9}ggttttcagatggccagaagctgctctttgcaaggggaaccatgttaaaggtggatctta
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment