Commit 75e5c2cf authored by Mikaël Salson's avatar Mikaël Salson

should-vdj-tests/BRI_multi.should-vdj.fa: Sequence is not buggy anymore

Doesn't seem to be new
parent 1e5ecdb4
......@@ -28,7 +28,7 @@ cggtatggacgtctggggccaagggaccacggtcaccgtctcctcagg
# target 1297RC
Markdown is supported
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment