Commit 745b47db authored by Mathieu Giraud's avatar Mathieu Giraud

tests: test segmentation details in json

parent 6c2d6a72
!REQUIRES: python ../../tools/check_python_version.py !REQUIRES: python ../../tools/check_python_version.py
!LAUNCH: ../../vidjil -z 1 -G ../../germline/IGH -w 60 -r 5 -e 10 -b data ../../data/Stanford_S22.fasta ; cat out/data.vidjil | python ../../tools/format_json.py -1 !LAUNCH: ../../vidjil -z 1 -G ../../germline/IGH -w 60 -r 5 -e 10 -b data ../../data/Stanford_S22.fasta > /dev/null ; cat out/data.vidjil | python ../../tools/format_json.py -1
$ Number of reads $ Number of reads
e1:"total": [13153] e1:"total": [13153]
...@@ -13,6 +13,27 @@ $ Most abundant window ...@@ -13,6 +13,27 @@ $ Most abundant window
$ Segmentation $ Segmentation
1:"name": "IGHV3-23.05 6/ACCCGGGAGGAACAATAT/9 IGHD6-13.01 0//5 IGHJ4.02" 1:"name": "IGHV3-23.05 6/ACCCGGGAGGAACAATAT/9 IGHD6-13.01 0//5 IGHJ4.02"
$ Segmentation details - V
1:"5": "IGHV3-23.05",
1:"5end": 54,
1:"5del": 6,
$ Segmentation details - D
1:"4delLeft": 9,
1:"4start": 73,
1:"4": "IGHD6-13.01",
1:"4end": 84,
1:"4delRight": 0,
$ Segmentation details - J
1:"3del": 5,
1:"3start": 85,
1:"3": "IGHJ4.02",
$ Segmentation details - N1, N2
1:"N1": 18,
1:"N2": 0,
$ Second sequence has a DNA sequence provided $ Second sequence has a DNA sequence provided
1:"id": "CTGTGCGAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTA".*"sequence": "[ACGT]+", 1:"id": "CTGTGCGAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTA".*"sequence": "[ACGT]+",
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment