Commit 7309e252 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: update tests, -G/IGH -> -g:IGH

parent 30a7bb0c
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -A -c clones -G $VIDJIL_DIR/germline/homo-sapiens/IGH $VIDJIL_DIR/data/test_representatives.fa
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -A -c clones -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DIR/data/test_representatives.fa
$ Three clones should be found
1:3 clones
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -G $VIDJIL_DIR/germline/homo-sapiens/TRG -c clones -A -3 $VIDJIL_DIR/data/segment_lec.fa
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:TRG -c clones -A -3 $VIDJIL_DIR/data/segment_lec.fa
$ Extract 50bp windows (TRG)
1:found . 50-windows
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -k 14 -w 50 -c clones -G $VIDJIL_DIR/germline/homo-sapiens/IGH -y 3 -z 1 -r 1 $VIDJIL_DIR/data/clones_simul.fa
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -k 14 -w 50 -c clones -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -y 3 -z 1 -r 1 $VIDJIL_DIR/data/clones_simul.fa
$ Junction extractions
1:found 25 50-windows in 66 reads
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -k 14 -w 50 -c clones -G $VIDJIL_DIR/germline/homo-sapiens/IGH -y 3 -z 0 -r 1 -n 5 $VIDJIL_DIR/data/clones_simul.fa ; cat out/clones_simul.vidjil
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -k 14 -w 50 -c clones -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -y 3 -z 0 -r 1 -n 5 $VIDJIL_DIR/data/clones_simul.fa ; cat out/clones_simul.vidjil
$ Window extractions
2:found 25 50-windows in 66 reads
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -KA -z 0 -s \\\\#\\\\#\\\\#\\\\#\\\\#-\\\\#\\\\#\\\\#\\\\#\\\\# -G $VIDJIL_DIR/germline/homo-sapiens/IGH $VIDJIL_DIR/data/common-V-D.fa ; cat out/common-V-D.affects
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -KA -z 0 -s \\\\#\\\\#\\\\#\\\\#\\\\#-\\\\#\\\\#\\\\#\\\\#\\\\# -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DIR/data/common-V-D.fa ; cat out/common-V-D.affects
$ Segments the sequence
1: SEG .* -> .* 1
......
!NO_LAUNCHER:
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -G $VIDJIL_DIR/germline/homo-sapiens/IGH $VIDJIL_DIR/data/clones_simul.fa > out-fa ; $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -G $VIDJIL_DIR/germline/homo-sapiens/IGH -b clones_simul $VIDJIL_DIR/data/clones_simul.fa.gz > out-fa-gz ; diff -s -I '\#' -I 'index' -I 'data/clones_simul' out-fa out-fa-gz ; echo 'Diff: '\\$?; wc -l out-fa-gz
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DIR/data/clones_simul.fa > out-fa ; $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -b clones_simul $VIDJIL_DIR/data/clones_simul.fa.gz > out-fa-gz ; diff -s -I '\#' -I 'index' -I 'data/clones_simul' out-fa out-fa-gz ; echo 'Diff: '\\$?; wc -l out-fa-gz
$ Identical output
1:Diff: 0
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -G $VIDJIL_DIR/germline/homo-sapiens/IGH -r 1 $VIDJIL_DIR/data/large_N.fa
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -r 1 $VIDJIL_DIR/data/large_N.fa
$ Find a huge insertion in the segmentation
1:>clone-001.*/[ACGT]{100}
!LAUNCH: (for i in {1..100000}; do echo '>read' ; echo ccgtgtattactgtgcgagagagctgaatacttccagcactg ; done ;) > same-igh-100k.fa ; $LAUNCHER $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -G $VIDJIL_DIR/germline/homo-sapiens/IGH -r 5000 -w 15 same-igh-100k.fa; rm -f same-igh-100k.fa
!LAUNCH: (for i in {1..100000}; do echo '>read' ; echo ccgtgtattactgtgcgagagagctgaatacttccagcactg ; done ;) > same-igh-100k.fa ; $LAUNCHER $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -r 5000 -w 15 same-igh-100k.fa; rm -f same-igh-100k.fa
$ Find a unique clone with all reads
1:>clone-001--IGH--0100000--100.--window
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -c segment -G $VIDJIL_DIR/germline/homo-sapiens/IGH -A $VIDJIL_DIR/data/overlap-d-j.fa | grep -v web | tail -4 | tr -d '\\\\n' | wc -c
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -c segment -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -A $VIDJIL_DIR/data/overlap-d-j.fa | grep -v web | tail -4 | tr -d '\\\\n' | wc -c
$ Exported sequence has all the bases
1:116
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -c clones -A -G $VIDJIL_DIR/germline/homo-sapiens/TRG -A $VIDJIL_DIR/data/segment_lec.fq > /dev/null ; cat out/segment_lec.vidjil
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -c clones -A -g $VIDJIL_DIR/germline/homo-sapiens.g:TRG -A $VIDJIL_DIR/data/segment_lec.fq > /dev/null ; cat out/segment_lec.vidjil
$ Window
1:"id": "GGGGTCTATTACTGTGCCACCTGGGCCTTATTATAAGAAACTCTTTGGCA"
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -A -G $VIDJIL_DIR/germline/homo-sapiens/TRG ../should-vdj-tests/ext-nucleotides-N.should-vdj.fa
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DIR/germline/homo-sapiens.g:TRG ../should-vdj-tests/ext-nucleotides-N.should-vdj.fa
$ Segments on TRG
1: TRG .* -> .* 1
......
!LAUNCH: $LAUNCHER $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -k 9 -G $VIDJIL_DIR/germline/homo-sapiens/IGH -K -c clones $VIDJIL_DIR/data/revcomp.fa ; grep 'X.X.X' out/revcomp.affects | sed 's/[^X]//g' | sort -u ; grep '#>' out/revcomp.affects | sed 's/.*SEG.../e-value:/' | cut -f 1 -d' '
!LAUNCH: $LAUNCHER $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -k 9 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -K -c clones $VIDJIL_DIR/data/revcomp.fa ; grep 'X.X.X' out/revcomp.affects | sed 's/[^X]//g' | sort -u ; grep '#>' out/revcomp.affects | sed 's/.*SEG.../e-value:/' | cut -f 1 -d' '
$ Segments both reads, normal and reverse
1:junction detected in 2 reads
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -G $VIDJIL_DIR/germline/homo-sapiens/IGH -c segment $VIDJIL_DIR/data/segment_S22.fa | grep '^>' ; cat out/segment_S22.vidjil | python $VIDJIL_DIR/tools/format_json.py -1
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -c segment $VIDJIL_DIR/data/segment_S22.fa | grep '^>' ; cat out/segment_S22.vidjil | python $VIDJIL_DIR/tools/format_json.py -1
$ First sequence Stanford
# 164 175 195 203
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -e 10 -G $VIDJIL_DIR/germline/homo-sapiens/IGH -W ACCGGTATTACT -W CAGCTGCTCCCC -W TGGGCCACTC -W ATCAACGCTGGCAATGGTAACACTAAATATTCACAGAAGTTCCAGGGCAGAGTCACCATTACCAGGGACACATACGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCTCTGTATTACTGTGCGAGAGTGCGCAGCAGCTGGTCTGATGCTTTTGATTATCTGG $VIDJIL_DIR/data/clones_simul.fa
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -e 10 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -W ACCGGTATTACT -W CAGCTGCTCCCC -W TGGGCCACTC -W ATCAACGCTGGCAATGGTAACACTAAATATTCACAGAAGTTCCAGGGCAGAGTCACCATTACCAGGGACACATACGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCTCTGTATTACTGTGCGAGAGTGCGCAGCAGCTGGTCTGATGCTTTTGATTATCTGG $VIDJIL_DIR/data/clones_simul.fa
$ ACCGGTATTACT is found (in window and representative and in the command line)
3:ACCGGTATTACT
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -y 0 -X 100 -G $VIDJIL_DIR/germline/homo-sapiens/IGH $VIDJIL_DIR/data/Stanford_S22.fasta
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -y 0 -X 100 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DIR/data/Stanford_S22.fasta
$ Skip the good number of reads
1:Processing every 131th read
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -\# FA -k 16 -z 0 -w 60 -r 5 -o out2 -uuu -U -v -G $VIDJIL_DIR/germline/homo-sapiens/IGH $VIDJIL_DIR/data/Stanford_S22.fasta ; tail out2/Stanford_S22.segmented.vdj.fa ; grep UNSEG out2/Stanford_S22.unsegmented.vdj.fa
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -\# FA -k 16 -z 0 -w 60 -r 5 -o out2 -uuu -U -v -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DIR/data/Stanford_S22.fasta ; tail out2/Stanford_S22.segmented.vdj.fa ; grep UNSEG out2/Stanford_S22.unsegmented.vdj.fa
# Testing uncommon and debug options
$ verbose (-v)
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -z 2 -r 5 -a -G $VIDJIL_DIR/germline/homo-sapiens/IGH $VIDJIL_DIR/data/Stanford_S22.fasta ; cat out/seq/clone.fa-2
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -z 2 -r 5 -a -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DIR/data/Stanford_S22.fasta ; cat out/seq/clone.fa-2
# Testing detailed clone output (-a)
$ Detailed clone output (out/seq/clone.fa-2), germline
......
!REQUIRES: python $VIDJIL_DIR/tools/check_python_version.py
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -z 0 -w 60 -G $VIDJIL_DIR/germline/homo-sapiens/IGH $VIDJIL_DIR/data/Stanford_S22.fasta ; python $VIDJIL_DIR/tools/fuse.py out/Stanford_S22.vidjil out/Stanford_S22.vidjil -o out/fused.data ; cat out/fused.data | python $VIDJIL_DIR/tools/format_json.py -1
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -z 0 -w 60 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DIR/data/Stanford_S22.fasta ; python $VIDJIL_DIR/tools/fuse.py out/Stanford_S22.vidjil out/Stanford_S22.vidjil -o out/fused.data ; cat out/fused.data | python $VIDJIL_DIR/tools/format_json.py -1
$ Points list
e1:"original_names": ["../../..//data/Stanford_S22.fasta", "../../..//data/Stanford_S22.fasta"]
......
!REQUIRES: python $VIDJIL_DIR/tools/check_python_version.py
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -3 -z 1 -G $VIDJIL_DIR/germline/homo-sapiens/IGH -w 60 -r 5 -e 10 -b data $VIDJIL_DIR/data/Stanford_S22.fasta > /dev/null ; cat out/data.vidjil | python $VIDJIL_DIR/tools/format_json.py -1
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -3 -z 1 -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa -w 60 -r 5 -e 10 -b data $VIDJIL_DIR/data/Stanford_S22.fasta > /dev/null ; cat out/data.vidjil | python $VIDJIL_DIR/tools/format_json.py -1
$ Custom germlines
1:"species": "custom germlines"
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -y 0 -k 14 -G $VIDJIL_DIR/germline/homo-sapiens/IGH $VIDJIL_DIR/data/Stanford_S22.fasta
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -y 0 -k 14 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DIR/data/Stanford_S22.fasta
!LOG: stanford-k14.log
$ Find the good number of windows in Stanford S22 (contiguous seed 14)
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -t 0 -G $VIDJIL_DIR/germline/homo-sapiens/IGH -FaW GAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACT $VIDJIL_DIR/data/Stanford_S22.fasta ; cat out/seq/clone.fa-1
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -t 0 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -FaW GAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACT $VIDJIL_DIR/data/Stanford_S22.fasta ; cat out/seq/clone.fa-1
$ Keep only one windows, the one given by -W, with only 5 reads (it is actually the second clone in Stanford_S22.fasta)
1: keep 1 windows in 5 reads
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -z 0 -G $VIDJIL_DIR/germline/homo-sapiens/IGH -r 5 -W GAGAGATGGACGGGATACGTAAAACGACATATGGTTCGGGGTTTGGTGCT $VIDJIL_DIR/data/Stanford_S22.fasta ; cat out/Stanford_S22.vidjil
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -z 0 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -r 5 -W GAGAGATGGACGGGATACGTAAAACGACATATGGTTCGGGGTTTGGTGCT $VIDJIL_DIR/data/Stanford_S22.fasta ; cat out/Stanford_S22.vidjil
$ Some clone has only one read, bypassing the -r 5 option, and the good label
1: clone-00..*0001-.* -W
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -z 0 -G $VIDJIL_DIR/germline/homo-sapiens/IGH -r 5 -l $VIDJIL_DIR/data/Stanford_S22.label $VIDJIL_DIR/data/Stanford_S22.fasta ; cat out/Stanford_S22.vidjil
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -z 0 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -r 5 -l $VIDJIL_DIR/data/Stanford_S22.label $VIDJIL_DIR/data/Stanford_S22.fasta ; cat out/Stanford_S22.vidjil
$ Some clone has only one read, bypassing the -r 5 option, and the good label
1: clone-00..*0001-.* my-clone
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -c segment -x 2 -G $VIDJIL_DIR/germline/homo-sapiens/IGH $VIDJIL_DIR/data/Stanford_S22.fasta
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -c segment -x 2 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DIR/data/Stanford_S22.fasta
$ Segments the good number of sequences in Stanford S22
2: >lcl
......
!REQUIRES: python $VIDJIL_DIR/tools/check_python_version.py
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -r 1 -z 5 -w 60 -G $VIDJIL_DIR/germline/homo-sapiens/IGH $VIDJIL_DIR/data/Stanford_S22.fasta ; python $VIDJIL_DIR/tools/vidjil-to-fasta.py -o out/S22.fasta out/Stanford_S22.vidjil ;
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -r 1 -z 5 -w 60 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DIR/data/Stanford_S22.fasta ; python $VIDJIL_DIR/tools/vidjil-to-fasta.py -o out/S22.fasta out/Stanford_S22.vidjil ;
!OUTPUT_FILE: out/S22.fasta
$ 5 representative sequences in the FASTA output file
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -e 10 -y 0 -s '#####-#####' -w 100 -G $VIDJIL_DIR/germline/homo-sapiens/IGH $VIDJIL_DIR/data/Stanford_S22.fasta
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -e 10 -y 0 -s '#####-#####' -w 100 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DIR/data/Stanford_S22.fasta
!LOG: stanford-w100.log
$ Find the good number of "too short sequences" for windows of size 100
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -y 0 -x 100 -G $VIDJIL_DIR/germline/homo-sapiens/IGH $VIDJIL_DIR/data/Stanford_S22.fasta
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -y 0 -x 100 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DIR/data/Stanford_S22.fasta
$ Analyze the good number of sequences in Stanford S22
1: found .* of 100 reads
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -A -G $VIDJIL_DIR/germline/homo-sapiens/TRB $VIDJIL_DIR/data/trb-only-VJ.fa ; cat out/trb-only-VJ.vidjil
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DIR/germline/homo-sapiens.g:TRB $VIDJIL_DIR/data/trb-only-VJ.fa ; cat out/trb-only-VJ.vidjil
$ Segments the read on TRB (the information is given twice, stdout + .vidjil)
2: TRB .* -> .* 1
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -w 10 -G $VIDJIL_DIR/germline/homo-sapiens/IGH $VIDJIL_DIR/data/Stanford-S22.fa 2>&1
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -w 10 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DIR/data/Stanford-S22.fa 2>&1
!EXIT_CODE: 1
$ Error, too small -w
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -A -G $VIDJIL_DIR/germline/homo-sapiens/IGH $VIDJIL_DIR/data/toy_V.fa
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DIR/data/toy_V.fa
$ Warning, -A
1:WARNING
......
!NO_LAUNCHER:
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -z 200 -G $VIDJIL_DIR/germline/homo-sapiens/IGH $VIDJIL_DIR/data/trd-dd2-dd3.fa
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -z 200 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DIR/data/trd-dd2-dd3.fa
$ Warning, -z
1:WARNING
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -G $VIDJIL_DIR/germline/homo-sapiens/IGH $VIDJIL_DIR/data/long-segmentation.fa
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DIR/data/long-segmentation.fa
$ Sequence should be segmented by k-mer segmenter
e1:SEG_+ -> 1
!LAUNCH: $LAUNCHER $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -z 1 -k 9 -G $VIDJIL_DIR/germline/homo-sapiens/IGH -% 0.001 -r 2 -x 1000 -y 1 -c clones $VIDJIL_DIR/data/Stanford_S22.fasta | sed 's/--IGH--.*VDJ\\(.*\\).$/\\1/' | sed 's/IGH SEG_./IGH SEG_X/' > vidjil_s22.log && $LAUNCHER $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -z 1 -k 9 -G $VIDJIL_DIR/germline/homo-sapiens/IGH -% 0.001 -r 2 -x 1000 -y 1 -c clones $VIDJIL_DIR/data/Stanford_S22.rc.fasta | sed 's/--IGH--.*VDJ\\(.*\\).$/\\1/' | sed 's/IGH SEG_./IGH SEG_X/' > vidjil_s22_rc.log && diff out/Stanford_S22{,.rc}.vidjil | grep GGG && diff vidjil_s22.log vidjil_s22_rc.log
!LAUNCH: $LAUNCHER $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -z 1 -k 9 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -% 0.001 -r 2 -x 1000 -y 1 -c clones $VIDJIL_DIR/data/Stanford_S22.fasta | sed 's/--IGH--.*VDJ\\(.*\\).$/\\1/' | sed 's/IGH SEG_./IGH SEG_X/' > vidjil_s22.log && $LAUNCHER $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -z 1 -k 9 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -% 0.001 -r 2 -x 1000 -y 1 -c clones $VIDJIL_DIR/data/Stanford_S22.rc.fasta | sed 's/--IGH--.*VDJ\\(.*\\).$/\\1/' | sed 's/IGH SEG_./IGH SEG_X/' > vidjil_s22_rc.log && diff out/Stanford_S22{,.rc}.vidjil | grep GGG && diff vidjil_s22.log vidjil_s22_rc.log
!EXIT_CODE: 1
$ Same number segmented
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment