Commit 70d0a875 authored by HERBERT Ryan's avatar HERBERT Ryan
Browse files

analysis-format.org Changed format of seg 5 and 3 gene to match new output

parent ca3f0aa7
......@@ -55,8 +55,8 @@ Note that other elements could be added by some program (such as =tag= or =clust
"top": 1,
"seg":
{
"5": "TRGV5*01", "5start": 1, "5end": 86,
"3": "TRGJ1*02", "3start": 89, "3end": 118,
"5": {"name": "TRGV5*01", "start": 1, "stop": 86},
"3": {"name": "TRGJ1*02", "start": 89, "stop": 118},
"cdr3": { "start": 77, "stop": 104, "seq": "gccacctgggccttattataagaaactc" }
}
......@@ -102,8 +102,8 @@ and 'IMGT clonotype (AA) or (nt)' could also be used by some programs).
"top": 1,
"seg":
{
"5": "TRGV5*01", "5start": 1, "5end": 86,
"3": "TRGJ1*02", "3start": 89, "3end": 118
"5": {"name": "TRGV5*01", "start": 1, "end": 86},
"3": {"name": "TRGJ1*02", "start": 89, "end": 118}
}
},
{
......@@ -121,8 +121,8 @@ and 'IMGT clonotype (AA) or (nt)' could also be used by some programs).
"top": 3,
"seg":
{
"5start": 1, "5end": 100,
"3start": 101, "3end": 200
"5": {"start": 1, "stop": 100},
"3": {"start": 101, "stop": 200}
}
}
]
......@@ -286,17 +286,17 @@ In the .analysis file, this section is intended to describe some specific clones
// names of V/D/J genes should match the ones in files referenced in germline/germline.data
// Positions must start at 1.
{
"5": "IGHV5*01",
"5start": 0,
"5end": 0,
"5": {"name": "IGHV5*01",
"start": 0,
"stop": 0},
"4": "IGHD1*01",
"4start": 0,
"4end": 0,
"4": {"name": "IGHD1*01",
"start": 0,
"stop": 0},
"3": "IGHJ3*02",
"3start": 0,
"3end": 0,
"3": {"name": "IGHJ3*02",
"start": 0,
"stop": 0},
// any feature to be highligthed in the sequenc
// the optional "seq" element gives a sequence that corresponds to this feature
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment