Merge branch 'feature-a/2232-tag-D7-27--J1' into 'dev'

D7-27--J1 non-recombination should be warned

Closes #2232

See merge request !242

algo/core/segment.cpp

@@ -249,6 +249,10 @@ int Segmenter::getRight() const {
   return box_J->start;
 }
 
+int Segmenter::getMidLength() const {
+  return box_J->start - box_V->end - 1;
+}
+
 int Segmenter::getLeftD() const {
   return box_D->start;
 }
@@ -1313,6 +1317,20 @@ void FineSegmenter::findCDR3(){
   // Reminder: JUNCTIONstart is 1-based
 }
 
+void FineSegmenter::checkWarnings(json &json_clone)
+{
+  if (isSegmented())
+    {
+      // Non-recombined D7-27/J1 sequence
+      if ((box_V->ref_label.find("IGHD7-27") != string::npos)
+          && (box_J->ref_label.find("IGHJ1") != string::npos)
+          && ((getMidLength() >= 90) || (getMidLength() <= 94)))
+        {
+          json_add_warning(json_clone, "W61", "Non-recombined D7-27/J1 sequence", LEVEL_ERROR);
+        }
+    }
+}
+
 json FineSegmenter::toJson(){
   json seg;
 

algo/core/segment.h

@@ -231,7 +231,14 @@ protected:
    * @return the right position (on forward strand) of the segmentation
    */
   int getRight() const;
+
   
+  /**
+   * @return the number of positions between the left and the right positions
+   */
+  int getMidLength() const;
+
+
   /**
    * @return the left position (on forward strand) of the D segmentation.
    */
@@ -390,6 +397,7 @@ class FineSegmenter : public Segmenter
    */
   void findCDR3();
 
+  void checkWarnings(json &json_clone);
   json toJson();
   
 };

algo/tests/data/D7-27--J1.fa

+>NC_000014.9:c105865580-105865420 Homo sapiens chromosome 14, GRCh38.p12 Primary Assembly
+TGAGCTGAGAACCACTGTGCTAACTGGGGACACAGTGATTGGCAGCTCTACAAAAACCATGCTCCCCCGG
+GACCCCGGGCTGTGGGTTTCTGTAGCCCCTGGCTCAGGGCTGACTCACCGTGGCTGAATACTTCCAGCAC
+TGGGGCCAGGGCACCCTGGTC
+
+
+

algo/tests/should-get-tests/colinear-D7-27--J1.should-get

+
+!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -KA  -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH+  -r 4  -b co  $VIDJIL_DATA/D7-27--J1.fa  ; cat out/co.vidjil
+
+# Test D7-27 0/92/0 J1 non-recombination
+
+$ Segmented on IGH+
+1: "germline": "IGH\+"
+
+$ Correct (non-)recombination
+1: "name": "IGHD7-27.01 0/[ACGT]{92}/0 IGHJ1.01"
+
+$ Warning
+1: "code": "W61"
+1: "msg": "Non-recombined D7-27/J1 sequence"
+

algo/tests/unit-tests/testSegment.cpp

@@ -159,6 +159,7 @@ void testSegmentationCause(IndexTypes index) {
                TEST_KMER_JUNCTION, ks.getInfoLineWithAffects());
       TAP_TEST_EQUAL(ks.getLeft(), 17, TEST_KMER_LEFT, "left = " << ks.getLeft());
       TAP_TEST_EQUAL(ks.getRight(), 18, TEST_KMER_RIGHT, "right = " << ks.getRight());
+      TAP_TEST_EQUAL(ks.getMidLength(), 0, TEST_KMER_RIGHT, "mid length = " << ks.getMidLength());
 
       ks.setSegmentationStatus(NOT_PROCESSED);
       TAP_TEST(! ks.isSegmented(), TEST_SET_SEGMENTATION_CAUSE, ks.getInfoLineWithAffects());

algo/vidjil.cpp

@@ -1424,6 +1424,8 @@ int main (int argc, char **argv)
 	      out_clone << endl;
 	   } // end if (seg.isSegmented())
 
+
+        seg.checkWarnings(json_clone);
         json_data_segment[it->first] = json_clone;
         
 	if (output_sequences_by_cluster) // -a option, output all sequences

doc/warnings.md

@@ -42,8 +42,8 @@ Warnings which were implemented ([x]) have a fixed code that should not be chang
 - [ ]     Possible strand ambiguity 
 
 *Strange recombination (FineSegmenter in vidjil-algo), V and J genes*
-- [ ] W6x Co-linear recombination D7-J1  #2232
 - [ ]     Potential co-linear genome match (pos xxxxxx) #1664 #1629 
+- [ ] W61 Non-recombined D7-27/J1 sequence  #2232
 - [ ]     Potential di-mer #2820 
 - [ ]     Very large deletion (xxx bp) #2909
 - [ ]     Unexpected recombination